Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1810 bp · TkA06G394690|TK1151|cDNA
AATTAATTTTGCTTTATTTAAGATATCGCGATCGAGATTGTCCGTGTAATAAAGTCACGGATCCTTCAAAACCCTCTGTCTTTTGTCTATAGGTAAGTCCTCAAAGCCTCAAAACCTGTTCTACCTAAAACCCTAACACGGCCATCATGACCACCGCCGGAGAAATAGAAGATGGCTTTCCGGCGACGAGACTCTTCAATCAAGGATACTCCTACACCTACGACGACGTTATCTTCCTCCCTCATTATATCGATTTCCCA...
1512 bp · TkA06G394690|TK1151|CDS
ATGACCACCGCCGGAGAAATAGAAGATGGCTTTCCGGCGACGAGACTCTTCAATCAAGGATACTCCTACACCTACGACGACGTTATCTTCCTCCCTCATTATATCGATTTCCCAACCGACTCCGTTCAACTAAACACGAAACTCTCTCGTAACATAAACCTCTCTGTACCATGCGTTGCTTCTCCGATGGACACTGTAACCGAAGCATCCATGGCTGTTTCCATGGCCGCGTTAGGTGGGATAGGAATCATCCACTCCAA...
Protein
Download Protein FASTA503 aa · TkA06G394690|TK1151|PROTEIN
MTTAGEIEDGFPATRLFNQGYSYTYDDVIFLPHYIDFPTDSVQLNTKLSRNINLSVPCVASPMDTVTEASMAVSMAALGGIGIIHSNNTASEQSSLIRSAKSHRIPFASTDIPFLSPDDSISSGSVFDNSPCVFITTNGSKSDKKLLGVVDKLTWEGLSDKEARVSSYMKKDPVTLPNTYKFEDVAGYLATKNLDFVPLVSGEGDVIDVVSKWDVERINGFPKSGLPSLGSDGEFLVGASIGTRETDKERLQQLVKAGVN...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA06G394690 |
|---|---|
| TK1151 ID | TkA06G394690 |
| OH-1004 ID | LXL04_023138 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 100.000 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA06G394690 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr06:97766452-97768559 (-) | |||||||||
| Description | Similar to IMPDH: Inosine-5'-monophosphate dehydrogenase 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006164 purine nucleotide biosynthetic process Biological Process GO:0006177 GMP biosynthetic process Biological Process GO:0006183 GTP biosynthetic process Biological Process GO:0007623 circadian rhythm Biological Process GO:0071353 cellular response to interleukin-4 Biological Process GO:0097294 'de novo' XMP biosynthetic process Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0045335 phagocytic vesicle Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G16350 ath:AT1G79470 ddi:DDB_G0283701 rno:301005 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00478IMPDH23-493 aaPF04481DUF56146-97 aaPF03060NMO48-99 aaPF02581TMP-TENI67-115 aaPF00571CBS108-122 aaPF00571CBS143-151 aaPF00571CBS165-215 aaPF06968BATS240-275 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA06G394690 | PF00478 | IMPDH | 23 | 493 | 7.3e-121 | 404.1 |
| TkA06G394690 | PF04481 | DUF561 | 46 | 97 | 0.029 | 14.3 |
| TkA06G394690 | PF03060 | NMO | 48 | 99 | 1e-08 | 35.7 |
| TkA06G394690 | PF02581 | TMP-TENI | 67 | 115 | 0.0059 | 16.7 |
| TkA06G394690 | PF00571 | CBS | 108 | 122 | 1.4e-05 | 26.0 |
| TkA06G394690 | PF00571 | CBS | 143 | 151 | 1.4e-05 | 26.0 |
| TkA06G394690 | PF00571 | CBS | 165 | 215 | 1.4e-05 | 26.0 |
| TkA06G394690 | PF06968 | BATS | 240 | 275 | 0.0008 | 20.2 |
| TkA06G394690 | PF00224 | PK | 240 | 284 | 0.0066 | 16.3 |
| TkA06G394690 | PF02581 | TMP-TENI | 244 | 319 | 0.0059 | 16.7 |
| TkA06G394690 | PF00977 | His_biosynth | 247 | 381 | 9.7e-05 | 22.6 |
| TkA06G394690 | PF04309 | G3P_antiterm | 247 | 300 | 0.46 | 10.6 |
| TkA06G394690 | PF04131 | NanE | 251 | 383 | 0.0056 | 16.6 |
| TkA06G394690 | PF01207 | Dus | 252 | 317 | 0.14 | 11.9 |
| TkA06G394690 | PF02581 | TMP-TENI | 280 | 377 | 0.0059 | 16.7 |
| TkA06G394690 | PF03060 | NMO | 293 | 388 | 1e-08 | 35.7 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.