TkA06G182870 | RubberDandelionOmics

Gene overview

TkA06G182870

Reference: TK1151 Chr: Chr06 Coordinates: 47748102-47751287 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1330 bp · TkA06G182870|TK1151|cDNA

TTAATAGCCGTAGCTTCAGCTGGGATATTCGTGCCCTTCTTGTTTTCTAGTAATCGTTCCCTTGTTGTCTAGTGGTTTCTATTAACTGCTCCGCTAAATACCTTTACCAAAAGCGACTGCTAGTGAACCACCATTTCAACGGAAATAGGCGAACATTGGTCCATGTTTCTTAAGCGCATAACATCCAATTCAATTCAAGAAACTTGAAGGTTACACCAGTTCCAACCACCATCTGTCAACAATGGGAAAGTCTCCAGGAA...

CDS

Download CDS FASTA

963 bp · TkA06G182870|TK1151|CDS

ATGGGAAAGTCTCCAGGAAAGTGGATCAAGACTAAACTTTTTGGGAAAAAATCATCGAAATCTAATCTCTCTAAAGATACTACTTTACAAAAAACGACCTCCATCTCTAACGATTCAATGGTGATCTCAAGCCCAGTCCCTCCTATCACCCATACCACTGAACAACACTCAGAGTTACACAAGACTTCAACAAATCCTACAACTGAAGTCACAAGAAGTCCCACTGAAGACAACTCAATCACTCTACAACAAGCTGCCAT...

Protein

Download Protein FASTA

320 aa · TkA06G182870|TK1151|PROTEIN

MGKSPGKWIKTKLFGKKSSKSNLSKDTTLQKTTSISNDSMVISSPVPPITHTTEQHSELHKTSTNPTTEVTRSPTEDNSITLQQAAIKAQTAFRGYSARKELSYLKATILLQAHIRGHLVRKQQLHTKGNSVISTKTESFPEQSQSELEKVKQSLRKITISMAASAPPPNPEPESEPEHVPEPEPKLESEPEPEPVAMTMESSGRESMKTRRRSSFPVKHEHVESVVVSSPVLPSYMAATESAKAKLRAQAVAEDGGENG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G182870`
TK1151 ID	TkA06G182870
OH-1004 ID	LXL04_006251
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	39.300
Protein coverage (%)	TK1151 95.312 / OH-1004 92.997 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G182870

Location Chr06:47748102-47751287 (-)

Description Similar to IQD31: Protein IQ-DOMAIN 31

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14380`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release
`At2g02790`	May be involved in cooperative interactions with calmodulins or calmodulin-like proteins (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_006251 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005635 nuclear envelope Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005856 cytoskeleton Cellular Component

GO:0005875 microtubule associated complex Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT1G14380

ath:AT1G18840

ath:AT1G74690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.437

Rank 1 · TkA06G182870 · TK1151

Cell membrane0.365

Rank 2 · TkA06G182870 · TK1151

Nucleus0.316

Rank 3 · TkA06G182870 · TK1151

Endoplasmic reticulum0.059

Rank 4 · TkA06G182870 · TK1151

Golgi apparatus0.039

Rank 5 · TkA06G182870 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05887Trypan_PARP31-67 aa

PF11871DUF339166-69 aa

PF00612IQ84-101 aa

PF13178DUF400592-150 aa

PF00612IQ106-123 aa

PF11871DUF3391143-199 aa

PF05887Trypan_PARP164-202 aa

PF13178DUF4005205-222 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G182870	`PF05887`	Trypan_PARP	31	67	1.1e-05	26.2
TkA06G182870	`PF11871`	DUF3391	66	69	1.7	9.9
TkA06G182870	`PF00612`	IQ	84	101	2.1e-10	40.2
TkA06G182870	`PF13178`	DUF4005	92	150	2.8e-08	35.0
TkA06G182870	`PF00612`	IQ	106	123	2.1e-10	40.2
TkA06G182870	`PF11871`	DUF3391	143	199	1.7	9.9
TkA06G182870	`PF05887`	Trypan_PARP	164	202	1.1e-05	26.2
TkA06G182870	`PF13178`	DUF4005	205	222	2.8e-08	35.0
TkA06G182870	`PF13178`	DUF4005	225	268	2.8e-08	35.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GZ87`	Arabidopsis thaliana	sp\|Q8GZ87\|IQD28_ARATH Protein IQ-DOMAIN 28	39.200%	Swiss-Prot	Low
`A0A1P8B0B7`	Arabidopsis thaliana	sp\|A0A1P8B0B7\|IQD29_ARATH Protein IQ-DOMAIN 29	40.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card