TkA06G152660 | RubberDandelionOmics

Gene overview

TkA06G152660

Reference: TK1151 Chr: Chr06 Coordinates: 39946557-39947498 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

942 bp · TkA06G152660|TK1151|cDNA

ATGAAGAACACCGTCAACAATGGCAGCACGAAGCTCATCCTTCTCCACCCCTACGTTCAAAAACAAGGTTCCTCTACTCGCCTCTATTGGCTAGTCGCCGCCGTCTCCATTTTTGCCGTAGCTTCCCTCCTCACATTCATTTACACACGCGAAACCTTCACCACCACCACCACCGTCACTGCAACTTCCATAACCATGGCTGCATCTACCGTCAACCGCCACATCCTGCCGAAATCAGTCACCAAAGCCCTGATTCACTA...

CDS

Download CDS FASTA

942 bp · TkA06G152660|TK1151|CDS

ATGAAGAACACCGTCAACAATGGCAGCACGAAGCTCATCCTTCTCCACCCCTACGTTCAAAAACAAGGTTCCTCTACTCGCCTCTATTGGCTAGTCGCCGCCGTCTCCATTTTTGCCGTAGCTTCCCTCCTCACATTCATTTACACACGCGAAACCTTCACCACCACCACCACCGTCACTGCAACTTCCATAACCATGGCTGCATCTACCGTCAACCGCCACATCCTGCCGAAATCAGTCACCAAAGCCCTGATTCACTA...

Protein

Download Protein FASTA

313 aa · TkA06G152660|TK1151|PROTEIN

MKNTVNNGSTKLILLHPYVQKQGSSTRLYWLVAAVSIFAVASLLTFIYTRETFTTTTTVTATSITMAASTVNRHILPKSVTKALIHYAANTNSSDHMSNTDIKHISDVLRQCPSPCNFLVFGLTPESLLWNALNHNGRTVFIDENRYYAAYIEEKHPEIEAYDVQYTTKISELNELVASVREQVHNECRPVQNLMFSDCKIGLNDLPNQLYELDWDIILVDGPRGYWPEGPGRMSAIFTAGVLARSKKGGNRKTHVFVHD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G152660`
TK1151 ID	TkA06G152660
OH-1004 ID	LXL04_024360
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G152660

Location Chr06:39946557-39947498 (-)

Description Similar to IRX15: Protein IRREGULAR XYLEM 15

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g50220`	Required for xylan biosynthesis, but not directly involved in catalyzing the addition of sugars to the growing polymer.	Arabidopsis genes IRREGULAR XYLEM (IRX15) and IRX15L encode DUF579-containing proteins that are essential for normal xylan deposition in the secondary cell wall.2011 · DOI: 10.1111/j.1365-313x.2011.04501.x The DUF579 domain containing proteins IRX15 and IRX15-L affect xylan synthesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04475.x
`At5g67210`	Required for xylan biosynthesis, but not directly involved in catalyzing the addition of sugars to the growing polymer.	The DUF579 domain containing proteins IRX15 and IRX15-L affect xylan synthesis in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2010.04475.x
`At1g09610`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138
`At1g33800`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138
`At4g09990`	Methyltransferase catalyzing 4-O-methylation of glucuronic acid side chains on xylan.	Three Arabidopsis DUF579 domain-containing GXM proteins are methyltransferases catalyzing 4-o-methylation of glucuronic acid on xylan.2012 · DOI: 10.1093/pcp/pcs138

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024360 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005976 polysaccharide metabolic process Biological Process

GO:0006479 protein methylation Biological Process

GO:0009808 lignin metabolic process Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0032259 methylation Biological Process

GO:0045491 xylan metabolic process Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005768 endosome Cellular Component

KEGG gene cross-reference

ath:AT1G09610

ath:AT1G33800

ath:AT1G67330

ath:AT3G50220

ath:AT5G67210

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.626

Rank 1 · TkA06G152660 · TK1151

Endoplasmic reticulum0.120

Rank 2 · TkA06G152660 · TK1151

Cell membrane0.091

Rank 3 · TkA06G152660 · TK1151

Extracellular0.083

Rank 4 · TkA06G152660 · TK1151

Cytoplasm0.078

Rank 5 · TkA06G152660 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15923DUF474560-112 aa

PF21729IRX15_IRX15L_GXM101-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G152660	`PF15923`	DUF4745	60	112	0.041	14.6
TkA06G152660	`PF21729`	IRX15_IRX15L_GXM	101	290	1.4e-80	270.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SNE5`	Arabidopsis thaliana	sp\|Q9SNE5\|IRX15_ARATH Protein IRREGULAR XYLEM 15	59.400%	Swiss-Prot	High
`Q9FH92`	Arabidopsis thaliana	sp\|Q9FH92\|IX15L_ARATH Protein IRX15-LIKE	61.100%	Swiss-Prot	High
`Q6NMK1`	Arabidopsis thaliana	sp\|Q6NMK1\|GXM1_ARATH Glucuronoxylan 4-O-methyltransferase 1	36.900%	Swiss-Prot	Medium
`Q9LQ32`	Arabidopsis thaliana	sp\|Q9LQ32\|GXM3_ARATH Glucuronoxylan 4-O-methyltransferase 3	44.800%	Swiss-Prot	Medium
`Q9T0F7`	Arabidopsis thaliana	sp\|Q9T0F7\|GXM2_ARATH Glucuronoxylan 4-O-methyltransferase 2	43.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card