RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA06G096510
Reference: TK1151 Chr: Chr06 Coordinates: 25677350-25684544 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4235 bp · TkA06G096510|TK1151|cDNA

AAAATACGTGAAGGAAATAGGGAAAAGAGGGAAAGAGTTTACAACCAAAGATTTGAGAGAGGGTGAGAGAGAAAGAGTGGTGTAGCTCGTCGGACTATCTTCTCCTCCACCTCCGTCTCCATCTTCATCATTTCTTCCGAATAACATCAAATCTCCTTCGTCTTTTTCACGATTTGTGAGAAATTAGGGATTTGTCAAAGGAAGAATTAATCAATGTCGAACAACAGGTGGAACTGGGAGGTGAGCGGTTTTGAACCAAG...

CDS

Download CDS FASTA

3783 bp · TkA06G096510|TK1151|CDS

ATGTCGAACAACAGGTGGAACTGGGAGGTGAGCGGTTTTGAACCAAGGGAATCTCCGGCCGAGCAGCCACCGTCTGCTCCTGCTCCTATTGTTCGGAGATACTCGATCTCTACTCCGCCAATTGCAGCACATTCCGAACTCATTTCTAGACAGTCTGTTGCCACCAAGCTTCATAATTTGACGGATAAGGTCAAGCATGCAAAAGAAGATTATGTAGAATTGAGACAAGAAGCCGTTGATCTTCAAGAGTACTCTAATGC...

Protein

Download Protein FASTA

1260 aa · TkA06G096510|TK1151|PROTEIN

MSNNRWNWEVSGFEPRESPAEQPPSAPAPIVRRYSISTPPIAAHSELISRQSVATKLHNLTDKVKHAKEDYVELRQEAVDLQEYSNAKLDRVTRYLGVLADKTRKLDEAALEAEAKVAPLINEKKRLYNELLTAKGNIKVFCRTRPLFEDEGPSVVEYPDDYTVRVNTGDDTVSNPKKDYEFDRVYGPHVGQAEFFTDVQPFVQSALDGHNVSVFAYGQTCSGKSHTMEGSSHDRGLYARCFEELFDVSNSDTTSTSRFN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA06G096510
TK1151 IDTkA06G096510
OH-1004 IDLXL04_024905
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)98.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA06G096510
LocationChr06:25677350-25684544 (-)
DescriptionSimilar to KIN14A: Kinesin-like protein KIN-14A
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g65460 Kinesin-like protein required for chloroplast movements and anchor to the plasma membrane.
Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis thaliana.2010 · DOI: 10.1073/pnas.0912773107
Light-Induced Movements of Chloroplasts and Nuclei Are Regulated in Both Cp-Actin-Filament-Dependent and -Independent Manners in Arabidopsis thaliana.2016 · DOI: 10.1371/journal.pone.0157429
At5g10470 Kinesin-like protein required for chloroplast movements and anchor to the plasma membrane.
Two kinesin-like proteins mediate actin-based chloroplast movement in Arabidopsis thaliana.2010 · DOI: 10.1073/pnas.0912773107
Light-Induced Movements of Chloroplasts and Nuclei Are Regulated in Both Cp-Actin-Filament-Dependent and -Independent Manners in Arabidopsis thaliana.2016 · DOI: 10.1371/journal.pone.0157429
At2g22610 Kinesin-like protein KIN-14R. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0217600 Kinesin-like protein KIN-14L. No verified direct reference in this release
Os03g0114000 Kinesin-like protein KIN-14E. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_024905 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000911 cytokinesis by cell plate formation Biological Process
GO:0000913 preprophase band assembly Biological Process
GO:0007017 microtubule-based process Biological Process
GO:0007018 microtubule-based movement Biological Process
GO:0009903 chloroplast avoidance movement Biological Process
GO:0009904 chloroplast accumulation movement Biological Process
GO:0031022 nuclear migration along microfilament Biological Process
GO:0005634 nucleus Cellular Component
GO:0005694 chromosome Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0005819 spindle Cellular Component
GO:0005829 cytosol Cellular Component
KEGG gene cross-reference
ath:AT2G22610
ath:AT5G10470
ath:AT5G65460
dosa:Os03g0114000
dosa:Os06g0217600
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.594
Rank 1 · TkA06G096510 · TK1151
Nucleus0.208
Rank 2 · TkA06G096510 · TK1151
Cell membrane0.196
Rank 3 · TkA06G096510 · TK1151
Golgi apparatus0.110
Rank 4 · TkA06G096510 · TK1151
Lysosome / Vacuole0.069
Rank 5 · TkA06G096510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02601Exonuc_VII_L35-130 aa
PF11155DUF293543-129 aa
PF05478Prominin51-133 aa
PF00261Tropomyosin76-135 aa
PF16796Microtub_bd123-277 aa
PF00225Kinesin143-441 aa
PF00261Tropomyosin450-494 aa
PF11155DUF2935453-557 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA06G096510PF02601Exonuc_VII_L351306.16.9
TkA06G096510PF11155DUF2935431290.2312.7
TkA06G096510PF05478Prominin511338.35.1
TkA06G096510PF00261Tropomyosin761356.16.9
TkA06G096510PF16796Microtub_bd1232771.8e-34119.6
TkA06G096510PF00225Kinesin1434411.1e-74252.1
TkA06G096510PF00261Tropomyosin4504946.16.9
TkA06G096510PF11155DUF29354535570.2312.7
TkA06G096510PF02601Exonuc_VII_L5236436.16.9
TkA06G096510PF29435MPS3_helical5246250.7810.5
TkA06G096510PF00261Tropomyosin5246266.16.9
TkA06G096510PF05478Prominin5406268.35.1
TkA06G096510PF16796Microtub_bd5605911.8e-34119.6
TkA06G096510PF11155DUF29356106730.2312.7
TkA06G096510PF02601Exonuc_VII_L97110116.16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FKP4Arabidopsis thalianasp|Q9FKP4|KN14B_ARATH Kinesin-like protein KIN-14B65.000%Swiss-ProtHigh
Q9LX99Arabidopsis thalianasp|Q9LX99|KN14A_ARATH Kinesin-like protein KIN-14A64.300%Swiss-ProtHigh
F4IJK6Arabidopsis thalianasp|F4IJK6|KN14R_ARATH Kinesin-like protein KIN-14R37.800%Swiss-ProtLow
B9FS74Oryza sativa subsp. japonicasp|B9FS74|KN14L_ORYSJ Kinesin-like protein KIN-14L62.200%Swiss-ProtHigh
B9FAF3Oryza sativa subsp. japonicasp|B9FAF3|KN14E_ORYSJ Kinesin-like protein KIN-14E38.000%Swiss-ProtLow

JBrowse

View in Genome Browser