TkA06G090970 | RubberDandelionOmics

Gene overview

TkA06G090970

Reference: TK1151 Chr: Chr06 Coordinates: 24220904-24227990 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1161 bp · TkA06G090970|TK1151|cDNA

TTGGAAGCCCATTTTTACAATGCTTTATACCTTGCATGATTATAAAAAGATAGTAATATTAGGTCAAAATGAAAAGTTGAAATGAAATGATAATGACCCTATTACTAGTTTATATTGAAAAACTTTGAACTAACCAATTGAGAAGCTACTGTACTTTTGTTCCTTGGGCTATTAGAGTCTCTCACTAAAGCCTTGTTATAAGACAATAAAATACTCTTTCATCTCATGGATGATCACCTTACCCTAGGAATCGACTCAAA...

CDS

Download CDS FASTA

750 bp · TkA06G090970|TK1151|CDS

ATGGATGATCACCTTACCCTAGGAATCGACTCAAACATGGAACCTCTAGAAAGCAACATCAATCCTTCACTTGATCATCATCATCATCGAAGGCAAGATCGTAGTCTTCCATTCATGCCTTTACCGGATGGTTCTAACAATAATCTAAACTTTAGTTTAACTGGAGATCATCAAACTGGTTCTTTCTATGATCCGATTACGCATCTCCCTACCATAGATGATATGGTCAAGCGGATATCTGGGGTTGAAATCTTGGGGAG...

Protein

Download Protein FASTA

249 aa · TkA06G090970|TK1151|PROTEIN

MDDHLTLGIDSNMEPLESNINPSLDHHHHRRQDRSLPFMPLPDGSNNNLNFSLTGDHQTGSFYDPITHLPTIDDMVKRISGVEILGSSKPTIFSSGVSGENKANTNYGYVGKKRKKNVKTEVEKPREVVHVRARRGEATDSHSLAERMRREKINQKLRCLQELVPGCYKTMGMSVMLDVTISYLRSLQNQIEFLSMKLSAASMFYDFNSAEMEALDTMKGVNGYEAQVMDRIGGEGYGDLAQFQSIWPL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G090970`
TK1151 ID	TkA06G090970
OH-1004 ID	LXL04_024980
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	91.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G090970

Location Chr06:24220904-24227990 (+)

Description Similar to BHLH75: Transcription factor bHLH75

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g25330`	Transcription factor bHLH75.	No verified direct reference in this release
`At1g18400`	Positive regulator of brassinosteroid signaling.	No verified direct reference in this release
`At1g73830`	Positive regulator of brassinosteroid signaling.	No verified direct reference in this release
`At3g23690`	Transcription factor bHLH77.	No verified direct reference in this release
`At5g50915`	Transcription factor bHLH137.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024980 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0042127 regulation of cell population proliferation Biological Process

GO:0071368 cellular response to cytokinin stimulus Biological Process

GO:1902448 positive regulation of shade avoidance Biological Process

GO:2000488 positive regulation of brassinosteroid biosynthetic process Biological Process

GO:2000762 regulation of phenylpropanoid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

KEGG gene cross-reference

ath:AT1G18400

ath:AT1G25330

ath:AT1G73830

ath:AT3G07340

ath:AT5G50915

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.975

Rank 1 · TkA06G090970 · TK1151

Cytoplasm0.093

Rank 2 · TkA06G090970 · TK1151

Cell membrane0.025

Rank 3 · TkA06G090970 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA06G090970 · TK1151

Plastid0.012

Rank 5 · TkA06G090970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH141-188 aa

PF23177bHLH_IRO3141-194 aa

PF23173bHLH_SAC51146-190 aa

PF29569DCT6_helical148-194 aa

PF23174bHLH_ILI152-203 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G090970	`PF00010`	HLH	141	188	1.3e-05	25.6
TkA06G090970	`PF23177`	bHLH_IRO3	141	194	0.033	15.3
TkA06G090970	`PF23173`	bHLH_SAC51	146	190	6.4e-06	26.7
TkA06G090970	`PF29569`	DCT6_helical	148	194	0.15	12.6
TkA06G090970	`PF23174`	bHLH_ILI	152	203	0.25	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`A4D998`	Arabidopsis thaliana	sp\|A4D998\|BH075_ARATH Transcription factor bHLH75	63.800%	Swiss-Prot	Medium
`Q8GZ13`	Arabidopsis thaliana	sp\|Q8GZ13\|BEE1_ARATH Transcription factor BEE 1	51.800%	Swiss-Prot	High
`Q8GWK7`	Arabidopsis thaliana	sp\|Q8GWK7\|BEE3_ARATH Transcription factor BEE 3	48.600%	Swiss-Prot	Medium
`Q9LK48`	Arabidopsis thaliana	sp\|Q9LK48\|BH077_ARATH Transcription factor bHLH77	46.000%	Swiss-Prot	Medium
`Q93W88`	Arabidopsis thaliana	sp\|Q93W88\|BH137_ARATH Transcription factor bHLH137	61.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card