TkA06G090260 | RubberDandelionOmics

Gene overview

TkA06G090260

Reference: TK1151 Chr: Chr06 Coordinates: 24032451-24034238 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1551 bp · TkA06G090260|TK1151|cDNA

GTAGAATAGAATGTATGTGTGTGGAGACAAGAATAGCCCCGGACCATCTCTCACGCTTGTTCATCTCTCTCTGCCAATCACACCATTTTCCAAAAATTTCTTCCAGAAGATCAAAAGTATTGCAGCAATCCAATTTCAATGAAGAACAATCAAATCTCAATCATCTCACCCTCCAAGACCTTCAATGCTCGATTTCAACTCCATAATCTCCTCTCTGTTATACTTTTCTTCGGATTCGGTTTATGTTTCGGTATCATCCT...

CDS

Download CDS FASTA

1170 bp · TkA06G090260|TK1151|CDS

ATGAAGAACAATCAAATCTCAATCATCTCACCCTCCAAGACCTTCAATGCTCGATTTCAACTCCATAATCTCCTCTCTGTTATACTTTTCTTCGGATTCGGTTTATGTTTCGGTATCATCCTCACATTCCATCTGAAAAACGTCTCATTCAATCTTCAATTCACGCAATTCTCTCTCTCCACCGACGAAATCGACACCGCGGACGTGTCCACATTGCCACCGCCACCGAAGATCAGACTGGAGAATTACATACATCCGAC...

Protein

Download Protein FASTA

389 aa · TkA06G090260|TK1151|PROTEIN

MKNNQISIISPSKTFNARFQLHNLLSVILFFGFGLCFGIILTFHLKNVSFNLQFTQFSLSTDEIDTADVSTLPPPPKIRLENYIHPTEVMHDLSDNELIWRASMVPKVAGYPFERTPKVAFMFLTRGPVLLSPLWEMFFKGHDGLFNIYVHSSGSPSNWTEPEHSVFHGRKIPSKEVEWGKVSMIEAERRLLANALLDFSNQRFVLLSETCIPLFNFSTIYSYLINSNHNFVESYDLPGPVGRGRYSSKMHPIVKLSEWR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G090260`
TK1151 ID	TkA06G090260
OH-1004 ID	LXL04_024991
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G090260

Location Chr06:24032451-24034238 (-)

Description Similar to BC10: Glycosyltransferase BC10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0170000`	Glycosyltransferase required for the regulation of cellulose biosynthesis in the cell wall.	BC10, a DUF266-containing and Golgi-located type II membrane protein, is required for cell-wall biosynthesis in rice (Oryza sativa L.).2009 · DOI: 10.1111/j.1365-313x.2008.03703.x A Novel FC116/BC10 Mutation Distinctively Causes Alteration in the Expression of the Genes for Cell Wall Polymer Synthesis in Rice.2016 · DOI: 10.3389/fpls.2016.01366

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_024991 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009664 plant-type cell wall organization Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0000139 Golgi membrane Cellular Component

GO:0016757 glycosyltransferase activity Molecular Function

KEGG gene cross-reference

dosa:Os05g0170000

osa:4337935

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.804

Rank 1 · TkA06G090260 · TK1151

Endoplasmic reticulum0.071

Rank 2 · TkA06G090260 · TK1151

Cell membrane0.062

Rank 3 · TkA06G090260 · TK1151

Cytoplasm0.053

Rank 4 · TkA06G090260 · TK1151

Extracellular0.035

Rank 5 · TkA06G090260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02485Branch119-347 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G090260	`PF02485`	Branch	119	347	1.3e-78	264.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q65XS5`	Oryza sativa subsp. japonica	sp\|Q65XS5\|BC10_ORYSJ Glycosyltransferase BC10	34.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card