TkA06G089920 | RubberDandelionOmics

Gene overview

TkA06G089920

Reference: TK1151 Chr: Chr06 Coordinates: 23903062-23909631 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2486 bp · TkA06G089920|TK1151|cDNA

CCGACACCTATGACTAAAATCACAACCACTAATCATATTGTAATAATTGGTTTATTGTTCTTGAAGTAGACGAATGAATAGTCAAGCTTTATGTTCAGCCATATAAATCTTTTTATCTCCCTCATATCTTAATTCATTCTTCCATGATCACGTTCGTCAAGGTCCCAAATGAAACACCACATACTTTTGTTCACCTTCTTGGTGTTTTTCAAAGGCTCTTTTTCTGTGGATCCATTCTACGAAGATTGTGCGCCTAAACA...

CDS

Download CDS FASTA

1860 bp · TkA06G089920|TK1151|CDS

ATGAAACACCACATACTTTTGTTCACCTTCTTGGTGTTTTTCAAAGGCTCTTTTTCTGTGGATCCATTCTACGAAGATTGTGCGCCTAAACATTGTGGTGATGGTAGGACCATAAAGTTTCCATTTTTCATTCAAGGTATTCAAGAATCACATTGTGGGTACCCGGGTTTCGAGATCCACTGCAACCATGGCTTCCCAATTCGTAATATTAGCTTCCCAGTTATTAATATATCCGGAAATAACTACTCATTTGAAAATAT...

Protein

Download Protein FASTA

619 aa · TkA06G089920|TK1151|PROTEIN

MKHHILLFTFLVFFKGSFSVDPFYEDCAPKHCGDGRTIKFPFFIQGIQESHCGYPGFEIHCNHGFPIRNISFPVINISGNNYSFENIDYEAGSMRLLNSPTITCLSAIKNVTLDGNLFRINGSSTSELVFLTNCSKELPTILTRYMTESCGGPPAVELVMDSDDANLGMAKEVCSHVVVAPVEEHGGEGRSKVVVDGRNYAEVANRGFTLFWSAQECVKCERSGGRCGYKWFKFQVLCFCPHSIETESCPNGTQKKRLKI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G089920`
TK1151 ID	TkA06G089920
OH-1004 ID	LXL04_025001
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	72.100
Protein coverage (%)	TK1151 53.796 / OH-1004 88.802 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G089920

Location Chr06:23903062-23909631 (+)

Description Similar to PR5K: PR5-like receptor kinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g66910`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.5.	No verified direct reference in this release
`At1g67000`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.8.	No verified direct reference in this release
`At1g66930`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.7.	No verified direct reference in this release
`At1g66920`	LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025001 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009620 response to fungus Biological Process

GO:0010038 response to metal ion Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0004675 transmembrane receptor protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0030247 polysaccharide binding Molecular Function

KEGG gene cross-reference

ath:AT1G66910

ath:AT1G66920

ath:AT5G38280

ath:AT5G39020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.878

Rank 1 · TkA06G089920 · TK1151

Cytoplasm0.081

Rank 2 · TkA06G089920 · TK1151

Endoplasmic reticulum0.077

Rank 3 · TkA06G089920 · TK1151

Nucleus0.052

Rank 4 · TkA06G089920 · TK1151

Lysosome / Vacuole0.022

Rank 5 · TkA06G089920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13947GUB_WAK_bind27-96 aa

PF14380WAK_assoc162-241 aa

PF07714PK_Tyr_Ser-Thr198-219 aa

PF13947GUB_WAK_bind226-238 aa

PF07714PK_Tyr_Ser-Thr322-593 aa

PF00069Pkinase324-591 aa

PF03109ABC1326-350 aa

PF03109ABC1433-476 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G089920	`PF13947`	GUB_WAK_bind	27	96	6.2e-13	49.6
TkA06G089920	`PF14380`	WAK_assoc	162	241	1.2e-13	52.3
TkA06G089920	`PF07714`	PK_Tyr_Ser-Thr	198	219	1.2e-43	150.0
TkA06G089920	`PF13947`	GUB_WAK_bind	226	238	6.2e-13	49.6
TkA06G089920	`PF07714`	PK_Tyr_Ser-Thr	322	593	1.2e-43	150.0
TkA06G089920	`PF00069`	Pkinase	324	591	5.4e-49	167.7
TkA06G089920	`PF03109`	ABC1	326	350	0.00013	21.9
TkA06G089920	`PF03109`	ABC1	433	476	0.00013	21.9
TkA06G089920	`PF14531`	Kinase-like	440	545	0.0038	17.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HQ20`	Arabidopsis thaliana	sp\|F4HQ20\|LRL25_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.5	38.400%	Swiss-Prot	Medium
`Q3ECH2`	Arabidopsis thaliana	sp\|Q3ECH2\|LRL28_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.8	39.100%	Swiss-Prot	Medium
`F4HQ23`	Arabidopsis thaliana	sp\|F4HQ23\|LRL27_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.7	39.500%	Swiss-Prot	Medium
`F4HQ22`	Arabidopsis thaliana	sp\|F4HQ22\|LRL24_ARATH LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.4	42.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card