TkA06G078260 | RubberDandelionOmics

Gene overview

TkA06G078260

Reference: TK1151 Chr: Chr06 Coordinates: 20990449-20994160 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1873 bp · TkA06G078260|TK1151|cDNA

CCCAACCCGACTGAAGTTAAAGAAATCGAACCGAAAGCTTAGATTCGACCCGAATTCTTTTTTCCAAAATCCGACTCAATGTTAGATCAGTCGACGAAACCCTAACCGAAACTCGTGCCAGAGCAGAGGAGAGATTTAGGCTTCCGGTTTCCCACTTCTGACTTCCGGCTTCTTCTGCTTTGGACCTAAGGGTGTAACTTCGATTTCTATCTCGCAACTTCTTCTGGGGTGAGGTGAGCTGGATATGATCTGCTGATATG...

CDS

Download CDS FASTA

1311 bp · TkA06G078260|TK1151|CDS

ATGAGTAGACTATCCTTTAGGCCACGGCCTCTAGACATTCACAAGAAGCTTCCAATTGTAAAATCTATAAAAGATTTTGAAGATGACGATACCCCTACTTCCACGCGTACACAGATGCTTCGCATTATTGCTGAATCTGATAATGATACCCAGGTACACCAAGTTCCTAGTAAGAAAACAGTTTCTGAAATACCAACTCCTGAGTACGTTATTGTGGATACATATGAAAGAGATTATTCTCCCACTTTCAATCAACCAGC...

Protein

Download Protein FASTA

436 aa · TkA06G078260|TK1151|PROTEIN

MSRLSFRPRPLDIHKKLPIVKSIKDFEDDDTPTSTRTQMLRIIAESDNDTQVHQVPSKKTVSEIPTPEYVIVDTYERDYSPTFNQPASYLRARGARAEIGDFVEYDLDNEDEDWLHEFNKERLMLPAEKFETIIFKLEVLDHKARERAGVITPTLGSPIPVLLTFDAAVEALQALSIQYGIFQSIYSYWKEKRERWLKPVLRRLQPPPPVNDTNPYNVFRPREKAHRLHTRRMQRRENNVQSFEKLRQVRRNLDQAKNLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G078260`
TK1151 ID	TkA06G078260
OH-1004 ID	LXL04_025155
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G078260`
Location	Chr06:20990449-20994160 (+)
Description	Similar to epl1: Enhancer of polycomb-like protein 1 (Neosartorya fumigata (strain ATCC MYA-4609 / Af293 / CBS 101355 / FGSC A1100)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_025155` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006281 DNA repair Biological Process GO:0006325 chromatin organization Biological Process GO:0006351 DNA-templated transcription Biological Process GO:0006357 regulation of transcription by RNA polymerase II Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:0051726 regulation of cell cycle Biological Process GO:1905168 positive regulation of double-strand break repair via homologous recombination Biological Process GO:2000779 regulation of double-strand break repair Biological Process GO:0000786 nucleosome Cellular Component GO:0005634 nucleus Cellular Component GO:0032777 piccolo histone acetyltransferase complex Cellular Component GO:0035267 NuA4 histone acetyltransferase complex Cellular Component
KEGG gene cross-reference	afm:AFUA_6G04530 hsa:26122 mmu:227867 xla:447433 xtr:448185 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.960

Rank 1 · TkA06G078260 · TK1151

Cytoplasm0.135

Rank 2 · TkA06G078260 · TK1151

Cell membrane0.017

Rank 3 · TkA06G078260 · TK1151

Mitochondrion0.012

Rank 4 · TkA06G078260 · TK1151

Endoplasmic reticulum0.007

Rank 5 · TkA06G078260 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10513EPL141-138 aa

PF10513EPL1263-269 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G078260	`PF10513`	EPL1	41	138	2.4e-09	38.7
TkA06G078260	`PF10513`	EPL1	263	269	2.4e-09	38.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card