TkA06G077610 | RubberDandelionOmics

Gene overview

TkA06G077610

Reference: TK1151 Chr: Chr06 Coordinates: 20816184-20821521 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2292 bp · TkA06G077610|TK1151|cDNA

ATGCGCTTTTGGGCCGAAGGATGTTGGGTAACCATCAGAGGTGACTCGAGTTTGTCACGATCTAGAGCATCATGCAAGACCCTTTGCAAGCTGTTGCAACAGGAGGTGGAAGGCACCGTGGTGCACCTTGGGATCAACGAAAGGAGCCCCGATGTATCTCACCCGGTACCGGCAACAATACAGACCATCCTCGAGACATTCAAGGACGTGTTCGAGATGCCCTCCGGGTTGTTTCCCCAAAGGTGCCACGAGCACTCTAT...

CDS

Download CDS FASTA

2292 bp · TkA06G077610|TK1151|CDS

ATGCGCTTTTGGGCCGAAGGATGTTGGGTAACCATCAGAGGTGACTCGAGTTTGTCACGATCTAGAGCATCATGCAAGACCCTTTGCAAGCTGTTGCAACAGGAGGTGGAAGGCACCGTGGTGCACCTTGGGATCAACGAAAGGAGCCCCGATGTATCTCACCCGGTACCGGCAACAATACAGACCATCCTCGAGACATTCAAGGACGTGTTCGAGATGCCCTCCGGGTTGTTTCCCCAAAGGTGCCACGAGCACTCTAT...

Protein

Download Protein FASTA

763 aa · TkA06G077610|TK1151|PROTEIN

MRFWAEGCWVTIRGDSSLSRSRASCKTLCKLLQQEVEGTVVHLGINERSPDVSHPVPATIQTILETFKDVFEMPSGLFPQRCHEHSIILKEGTVPVTVRPYRYMHTQKDEIERLVIHEDRLMIDRSKMATIQDKFPIRLEGLVREYVDRFESLAGQLLDLSEKVLESTFVKGLKPYTRAAIRVTEPESLAQAMRMAITIDENKPVGNERGDEEEEETNHAHLNAVVVSLMSISRLTSPTIMKVRGDVRGTTVVVLIDCRA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G077610`
TK1151 ID	TkA06G077610
OH-1004 ID	LXL04_022427
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	37.600
Protein coverage (%)	TK1151 78.768 / OH-1004 30.837 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G077610

Location Chr06:20816184-20821521 (-)

Description Similar to THO2: THO complex subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`AtMg00860`	Uncharacterized mitochondrial protein AtMg00860.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022427 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006397 mRNA processing Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0008380 RNA splicing Biological Process

GO:0035196 miRNA processing Biological Process

GO:1990428 miRNA transport Biological Process

GO:0000347 THO complex Cellular Component

GO:0000445 THO complex part of transcription export complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0016607 nuclear speck Cellular Component

GO:0003723 RNA binding Molecular Function

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G24706

cjc:100399788

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.701

Rank 1 · TkA06G077610 · TK1151

Nucleus0.254

Rank 2 · TkA06G077610 · TK1151

Mitochondrion0.099

Rank 3 · TkA06G077610 · TK1151

Peroxisome0.067

Rank 4 · TkA06G077610 · TK1151

Endoplasmic reticulum0.055

Rank 5 · TkA06G077610 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30931DUF876457-69 aa

PF04398DUF53871-113 aa

PF30901PEG10-RTL1_C-capsid142-201 aa

PF19259Ty3_capsid143-220 aa

PF30931DUF8764149-196 aa

PF08284RVP_2231-277 aa

PF13650Asp_protease_2243-318 aa

PF13975gag-asp_proteas244-318 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G077610	`PF30931`	DUF8764	57	69	0.26	12.3
TkA06G077610	`PF04398`	DUF538	71	113	0.29	12.3
TkA06G077610	`PF30901`	PEG10-RTL1_C-capsid	142	201	0.00035	21.2
TkA06G077610	`PF19259`	Ty3_capsid	143	220	5.2e-06	26.7
TkA06G077610	`PF30931`	DUF8764	149	196	0.26	12.3
TkA06G077610	`PF08284`	RVP_2	231	277	0.015	15.8
TkA06G077610	`PF13650`	Asp_protease_2	243	318	1.4e-05	26.4
TkA06G077610	`PF13975`	gag-asp_proteas	244	318	1.9e-05	25.9
TkA06G077610	`PF30931`	DUF8764	333	345	0.26	12.3
TkA06G077610	`PF04398`	DUF538	347	382	0.29	12.3
TkA06G077610	`PF00078`	RVT_1	414	463	2.9e-11	44.3
TkA06G077610	`PF00078`	RVT_1	465	504	2.9e-11	44.3
TkA06G077610	`PF17921`	Integrase_H2C2	630	680	8.9e-15	55.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92523`	Arabidopsis thaliana	sp\|P92523\|M860_ARATH Uncharacterized mitochondrial protein AtMg00860	56.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card