TkA06G058240 | RubberDandelionOmics

Gene overview

TkA06G058240

Reference: TK1151 Chr: Chr06 Coordinates: 15722700-15724848 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1791 bp · TkA06G058240|TK1151|cDNA

ATGAAATTATTGAAAGCGGATGGAACACTAAACGGGACGACAGGGCTGAACAGACATTGGAGGGGATGTAAAGCCAACCCGGAAAACCAACAATCGGATGATGACAAACAATCGAAGTTGTCATTCAAGAAGGACCCAACCGGAGAAGGCCATGTATATACATGGAAACATGACGAAGTCAGAATAGCAAAATCAAATTTAGGTATCTTCACCATTGGAGAACTCCCTTTCAAGTGGCTTGAAAATGAAGCATGTATCGA...

CDS

Download CDS FASTA

1791 bp · TkA06G058240|TK1151|CDS

ATGAAATTATTGAAAGCGGATGGAACACTAAACGGGACGACAGGGCTGAACAGACATTGGAGGGGATGTAAAGCCAACCCGGAAAACCAACAATCGGATGATGACAAACAATCGAAGTTGTCATTCAAGAAGGACCCAACCGGAGAAGGCCATGTATATACATGGAAACATGACGAAGTCAGAATAGCAAAATCAAATTTAGGTATCTTCACCATTGGAGAACTCCCTTTCAAGTGGCTTGAAAATGAAGCATGTATCGA...

Protein

Download Protein FASTA

596 aa · TkA06G058240|TK1151|PROTEIN

MKLLKADGTLNGTTGLNRHWRGCKANPENQQSDDDKQSKLSFKKDPTGEGHVYTWKHDEVRIAKSNLGIFTIGELPFKWLENEACIELVNALNGRVILPSRHTASRNVAQLYLDERSKLLKHLSNPNTTVHLTTDTWTSPCQRKNYMVVTAHFIDDDWVMHKRVVNFREVDTHKGEDMARELLVCIHEWGMKKVMSMTVDNAKSNDMAIKYLVKKLPNVYDNGNQFHIRCMAHIINLIVKMGLKHQNYHVECVQNAVKYI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G058240`
TK1151 ID	TkA06G058240
OH-1004 ID	LXL04_023646
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.500
Protein coverage (%)	TK1151 100.000 / OH-1004 76.970 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G058240

Location Chr06:15722700-15724848 (-)

Description Similar to Putative AC transposase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_023646 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009791 post-embryonic development Biological Process

GO:0032196 transposition Biological Process

GO:0005634 nucleus Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

dosa:Os03g0733400

dosa:Os05g0239150

dosa:Os05g0583200

osa:4339741

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.933

Rank 1 · TkA06G058240 · TK1151

Cytoplasm0.116

Rank 2 · TkA06G058240 · TK1151

Mitochondrion0.025

Rank 3 · TkA06G058240 · TK1151

Cell membrane0.013

Rank 4 · TkA06G058240 · TK1151

Extracellular0.012

Rank 5 · TkA06G058240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04937DUF659124-244 aa

PF27041ZBED1_RNase-like133-216 aa

PF26742DUF8247144-193 aa

PF01450KARI_C181-208 aa

PF27039ZBED1_RNase-like_helical228-324 aa

PF01450KARI_C229-280 aa

PF14372hAT-like_RNase-H248-261 aa

PF27046FAM200-GTF2IRD2-like249-319 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G058240	`PF04937`	DUF659	124	244	6.6e-06	26.5
TkA06G058240	`PF27041`	ZBED1_RNase-like	133	216	1.8e-20	73.6
TkA06G058240	`PF26742`	DUF8247	144	193	0.026	15.2
TkA06G058240	`PF01450`	KARI_C	181	208	0.52	11.3
TkA06G058240	`PF27039`	ZBED1_RNase-like_helical	228	324	5.3e-21	75.4
TkA06G058240	`PF01450`	KARI_C	229	280	0.52	11.3
TkA06G058240	`PF14372`	hAT-like_RNase-H	248	261	0.15	13.0
TkA06G058240	`PF27046`	FAM200-GTF2IRD2-like	249	319	0.00091	19.8
TkA06G058240	`PF14372`	hAT-like_RNase-H	361	386	0.15	13.0
TkA06G058240	`PF01450`	KARI_C	383	418	0.52	11.3
TkA06G058240	`PF27046`	FAM200-GTF2IRD2-like	458	475	0.00091	19.8
TkA06G058240	`PF05699`	Dimer_Tnp_hAT	473	554	1.5e-26	92.7
TkA06G058240	`PF27041`	ZBED1_RNase-like	550	589	1.8e-20	73.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	25.400%	Swiss-Prot	Low
`Q75HY5`	Oryza sativa subsp. japonica	sp\|Q75HY5\|RSLE3_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 3	25.200%	Swiss-Prot	Low
`B9FJG3`	Oryza sativa subsp. japonica	sp\|B9FJG3\|RSLE1_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 1	24.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card