TkA06G045210 | RubberDandelionOmics

Gene overview

TkA06G045210

Reference: TK1151 Chr: Chr06 Coordinates: 12245837-12253109 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4603 bp · TkA06G045210|TK1151|cDNA

CTCAGTTTGAATTCGAGCTGGTATAACAAGCTGGTATAACCAAAACTAGGGCTGCAGGCCTTTTCCCCAAATTGCCTTTCATTGGCTCCTGCAAATACTTCAACTACGTTATTCTCGATTACTTATTCTTTTCGATCAGCTGGCGATCGGCAACGGCCAAAACCTTCGCTGTAATCGGTTTTACAGGCTATTCTAGCTCGTGAAAAAGAATGTATTCCAGGGGGAATAATTCGTATGGGCAACAACAACAACAACAACAA...

CDS

Download CDS FASTA

1380 bp · TkA06G045210|TK1151|CDS

ATGTATTCCAGGGGGAATAATTCGTATGGGCAACAACAACAACAACAACAACAACAGCAACAACAGCCAAAGCCACAGTCCTACTCTGGTCAATCTGCCTACGGTCAAAATGTGGGAGCTGATAATGCCTCTCAGATGCCCATGGCTTCACGCCATTCCACCTTATTAGGTGGTCATCCATCTGGAACTCATTATGGTGGTCAATATTCTTCTGTGTATGGTTCAACCGCACTCAACAGTGCTCTACAGGTCCCACCTAC...

Protein

Download Protein FASTA

459 aa · TkA06G045210|TK1151|PROTEIN

MYSRGNNSYGQQQQQQQQQQQQPKPQSYSGQSAYGQNVGADNASQMPMASRHSTLLGGHPSGTHYGGQYSSVYGSTALNSALQVPPTSNKGAGPSILEGRSGYGSTMQDSPKFTSGDYPASSQKYGQKGEKMLTDYQSGDRLPYAERPSAYSGRDLQNDSSVRFADSIAFGHQHQPDIYDRLDAASALRQELLHAQSLQSASVDSSSRQADYLARAATVRHAGQELLPYGARMDADLHAMSMISGTPSILGAAPRREVED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G045210`
TK1151 ID	TkA06G045210
OH-1004 ID	LXL04_025691
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.600
Protein coverage (%)	TK1151 91.939 / OH-1004 26.419 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G045210

Location Chr06:12245837-12253109 (+)

Description Similar to RSA1: Protein SHORT ROOT IN SALT MEDIUM 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03150`	Required for salt tolerance and sodium (Na) homeostasis after salt stress.	A nuclear calcium-sensing pathway is critical for gene regulation and salt stress tolerance in Arabidopsis.2013 · DOI: 10.1371/journal.pgen.1003755

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_025691 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006974 DNA damage response Biological Process

GO:0008284 positive regulation of cell population proliferation Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009411 response to UV Biological Process

GO:0009651 response to salt stress Biological Process

GO:0016055 Wnt signaling pathway Biological Process

GO:0030308 negative regulation of cell growth Biological Process

GO:0030335 positive regulation of cell migration Biological Process

GO:0031647 regulation of protein stability Biological Process

KEGG gene cross-reference

ath:AT2G03150

hsa:55749

hsa:57805

mmu:219158

mmu:67500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.974

Rank 1 · TkA06G045210 · TK1151

Cytoplasm0.142

Rank 2 · TkA06G045210 · TK1151

Cell membrane0.012

Rank 3 · TkA06G045210 · TK1151

Mitochondrion0.012

Rank 4 · TkA06G045210 · TK1151

Lysosome / Vacuole0.005

Rank 5 · TkA06G045210 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05887Trypan_PARP321-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G045210	`PF05887`	Trypan_PARP	321	360	8.9	7.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4IS91`	Arabidopsis thaliana	sp\|F4IS91\|RSA1_ARATH Protein SHORT ROOT IN SALT MEDIUM 1	44.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card