TkA06G029810 | RubberDandelionOmics

Gene overview

TkA06G029810

Reference: TK1151 Chr: Chr06 Coordinates: 8073668-8079964 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3266 bp · TkA06G029810|TK1151|cDNA

TGCAACTGCCGTAATTTTCTCAGGTACCCATTCACATCGTCAATTACTCTTTTACTCTGCCAATTTCAAAGCATCAATGACAATAGTGTGAATTGTTCTTTTGCAGAGATCACAATAAGAGTAGGAAAATCAGAATCATAGCAGGTTCTAAGATGGGAGAGAGTGCAGCGGCATCCGCGATTAAAATGGTTTTTGAACCGATTCTTGAAGAAGGTGTTTTCAGGTTCGATTGTTCAGCTGATGCTAGAACCGAAGCATTT...

CDS

Download CDS FASTA

3114 bp · TkA06G029810|TK1151|CDS

ATGGATTCGTATATTCATAACTTCCCAACTTTATTTTTCACTCCTACTTCTTTGATTCCGAACAAAATTCTCAAGAATCCCAACCCGATTTCATGCAACTGCCGTAATTTTCTCAGAGATCACAATAAGAGTAGGAAAATCAGAATCATAGCAGGTTCTAAGATGGGAGAGAGTGCAGCGGCATCCGCGATTAAAATGGTTTTTGAACCGATTCTTGAAGAAGGTGTTTTCAGGTTCGATTGTTCAGCTGATGCTAGAAC...

Protein

Download Protein FASTA

1037 aa · TkA06G029810|TK1151|PROTEIN

MDSYIHNFPTLFFTPTSLIPNKILKNPNPISCNCRNFLRDHNKSRKIRIIAGSKMGESAAASAIKMVFEPILEEGVFRFDCSADARTEAFPSVSFVNSKHRETPITSNHKVPSYIPTSEHVSGQQIVYFELPAGTSFYGTGEVSGPLERTGKRVFTWNTDAWGYGTGTTSLYQSHPWILAILPNGEAFGFLADTTKRCEIDLRKESTAKLIAPSPFPVVTFGPFDSVTDVLTSLSHAVGTVFMPPKWSLGYQQCRWSYDS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G029810`
TK1151 ID	TkA06G029810
OH-1004 ID	LXL04_026052
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G029810

Location Chr06:8073668-8079964 (-)

Description Similar to Alpha-glucosidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63840`	Cleaves sequentially the 2 innermost alpha-1,3-linked glucose residues from the Glc(2)Man(9)GlcNAc(2) oligosaccharide precursor of immature glycoproteins (By similarity).	The cellulose-deficient Arabidopsis mutant rsw3 is defective in a gene encoding a putative glucosidase II, an enzyme processing N-glycans during ER quality control.2002 · DOI: 10.1046/j.1365-313x.2002.01483.x Uncoupling of sustained MAMP receptor signaling from early outputs in an Arabidopsis endoplasmic reticulum glucosidase II allele.2009 · DOI: 10.1073/pnas.0907711106

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026052 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006491 N-glycan processing Biological Process

GO:0006952 defense response Biological Process

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005788 endoplasmic reticulum lumen Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0016020 membrane Cellular Component

GO:0017177 glucosidase II complex Cellular Component

GO:0043231 intracellular membrane-bounded organelle Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0003723 RNA binding Molecular Function

KEGG gene cross-reference

dosa:Os03g0216600

hsa:23193

mmu:14376

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.905

Rank 1 · TkA06G029810 · TK1151

Cytoplasm0.081

Rank 2 · TkA06G029810 · TK1151

Mitochondrion0.051

Rank 3 · TkA06G029810 · TK1151

Peroxisome0.045

Rank 4 · TkA06G029810 · TK1151

Cell membrane0.034

Rank 5 · TkA06G029810 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13802Gal_mutarotas_271-102 aa

PF13802Gal_mutarotas_2123-201 aa

PF01055Glyco_hydro_31_2nd242-571 aa

PF11055Gsf2323-374 aa

PF21365Glyco_hydro_31_3rd579-655 aa

PF17137DUF5110675-740 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G029810	`PF13802`	Gal_mutarotas_2	71	102	4.1e-19	70.3
TkA06G029810	`PF13802`	Gal_mutarotas_2	123	201	4.1e-19	70.3
TkA06G029810	`PF01055`	Glyco_hydro_31_2nd	242	571	2e-125	419.2
TkA06G029810	`PF11055`	Gsf2	323	374	0.083	12.4
TkA06G029810	`PF21365`	Glyco_hydro_31_3rd	579	655	2.4e-05	25.4
TkA06G029810	`PF17137`	DUF5110	675	740	2.3e-10	41.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FN05`	Arabidopsis thaliana	sp\|Q9FN05\|PSL5_ARATH Probable glucan 1,3-alpha-glucosidase	32.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card