TkA06G022000 | RubberDandelionOmics

Gene overview

TkA06G022000

Reference: TK1151 Chr: Chr06 Coordinates: 6057417-6060883 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · TkA06G022000|TK1151|cDNA

ATGAGGAAAAGACTCGAGAAACATACAGATAGAGGTTTGTGTGTTCCTGCTGATGATCTTCTAATAAATGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGGTGTGGGGATAAATACAGAATGGGGTTTGTTAATGGCAAGCATTTCAGACACTGCTGAAGA...

CDS

Download CDS FASTA

1017 bp · TkA06G022000|TK1151|CDS

ATGAGGAAAAGACTCGAGAAACATACAGATAGAGGTTTGTGTGTTCCTGCTGATGATCTTCTAATAAATGGTCACTCTCTAGCCATTGATGAATCTAGCATGACGGGAGAAAGCAAGATTGCACACAAGGATCAAAAATCACCTTTTTTAATGTATGGATGCAAAGTAGCAGATGGTGCAGGAACCATGATGGTAACTGGTGTGGGGATAAATACAGAATGGGGTTTGTTAATGGCAAGCATTTCAGACACTGCTGAAGA...

Protein

Download Protein FASTA

338 aa · TkA06G022000|TK1151|PROTEIN

MRKRLEKHTDRGLCVPADDLLINGHSLAIDESSMTGESKIAHKDQKSPFLMYGCKVADGAGTMMVTGVGINTEWGLLMASISDTAEETPLQVWLNGVATFIDIVSFIELCQKLDLLVMLRAGPYICAEWDFGGFPAWLLTKEPSIRLRSSDPVYLTLVDKWWGTLLPKIALLLYHKGGPIVMLQMAHGGTNFGFYNGVNAQESESNYLADLTSYDYDAPISESGYVDGAKFKASRSVIAMYSAASLSPVPKNNEKTGYGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G022000`
TK1151 ID	TkA06G022000
OH-1004 ID	LXL04_026190
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	79.200
Protein coverage (%)	TK1151 94.970 / OH-1004 99.506 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G022000

Location Chr06:6057417-6060883 (-)

Description Similar to GLB1: Beta-galactosidase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g72990`	Beta-galactosidase 17.	No verified direct reference in this release
`At3g21180`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell or into organelles.	No verified direct reference in this release
`At5g57110`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os05g0539400`	Beta-galactosidase 8.	No verified direct reference in this release
`Os04g0605500`	This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol out of the cell, into the endoplasmic reticulum, or into organelles (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026190 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006689 ganglioside catabolic process Biological Process

GO:0019388 galactose catabolic process Biological Process

GO:0042340 keratan sulfate proteoglycan catabolic process Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005764 lysosome Cellular Component

GO:0005773 vacuole Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0048046 apoplast Cellular Component

GO:0004565 beta-galactosidase activity Molecular Function

KEGG gene cross-reference

ath:AT1G72990

bta:507188

dosa:Os05g0539400

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.384

Rank 1 · TkA06G022000 · TK1151

Endoplasmic reticulum0.191

Rank 2 · TkA06G022000 · TK1151

Cytoplasm0.141

Rank 3 · TkA06G022000 · TK1151

Lysosome / Vacuole0.122

Rank 4 · TkA06G022000 · TK1151

Cell membrane0.097

Rank 5 · TkA06G022000 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00122E1-E2_ATPase12-80 aa

PF01301Glyco_hydro_35101-185 aa

PF01301Glyco_hydro_35184-240 aa

PF21317BetaGal_ABD_1287-329 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G022000	`PF00122`	E1-E2_ATPase	12	80	1.4e-08	35.1
TkA06G022000	`PF01301`	Glyco_hydro_35	101	185	9e-46	157.6
TkA06G022000	`PF01301`	Glyco_hydro_35	184	240	9e-46	157.6
TkA06G022000	`PF21317`	BetaGal_ABD_1	287	329	1.5e-05	25.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z24`	Arabidopsis thaliana	sp\|Q93Z24\|BGA17_ARATH Beta-galactosidase 17	38.700%	Swiss-Prot	Medium
`Q9LU41`	Arabidopsis thaliana	sp\|Q9LU41\|ACA9_ARATH Calcium-transporting ATPase 9, plasma membrane-type	75.500%	Swiss-Prot	Low
`Q9LF79`	Arabidopsis thaliana	sp\|Q9LF79\|ACA8_ARATH Calcium-transporting ATPase 8, plasma membrane-type	61.200%	Swiss-Prot	Low
`Q0DGD7`	Oryza sativa subsp. japonica	sp\|Q0DGD7\|BGAL8_ORYSJ Beta-galactosidase 8	39.400%	Swiss-Prot	Medium
`Q7X8B5`	Oryza sativa subsp. japonica	sp\|Q7X8B5\|ACA5_ORYSJ Calcium-transporting ATPase 5, plasma membrane-type	75.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card