TkA06G016920 | RubberDandelionOmics

Gene overview

TkA06G016920

Reference: TK1151 Chr: Chr06 Coordinates: 4594424-4599111 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1025 bp · TkA06G016920|TK1151|cDNA

TTGATATTAGCAAGTGCCTAAGTTATTGGCCGCTTAAAGTGTAATGCTTGATTTTCCAATCAAATACCGACAAAAAGACACTTGCATTAGTTAATCAAGTATTTAGAAACATGGGTAGTTTTGTCATTTTAGTGTTTATCCTTTTCTAGTGTATTGTTGTCCTCCCATGGACACTTGGATATCTCCTCTGCAAAACAAAGCAATAGCTCATCTCACGAAACCCTAATTTATAGCCCACTTGCTGTGTAGCTTATCCATTT...

CDS

Download CDS FASTA

474 bp · TkA06G016920|TK1151|CDS

ATGGCGAATCTGTATGTACAAGCGGCGCCGCCGACGGATCTCAACAGGAATACAGAGTGGTTCACATACCCCGGCGTCTGGATCACCTACATACTCACCCTCTTCTTCGCTTGGCTCGCCGTTCTCTCCGTTTTCGGCTGTTCTCCTGGCGTTGCTTGGACCATCGTCAATCTCGCTCACGCCGTGATGACATACCACTTCTTCCACTGGAAAAAAGGAACACCATTTGCCGATGACCAGGGCATCTACAACAGACTAAC...

Protein

Download Protein FASTA

157 aa · TkA06G016920|TK1151|PROTEIN

MANLYVQAAPPTDLNRNTEWFTYPGVWITYILTLFFAWLAVLSVFGCSPGVAWTIVNLAHAVMTYHFFHWKKGTPFADDQGIYNRLTWWEQIDSGKQLTRNRKFLTLVPLVLYLIASHTTDYQNPMLILNTVAVFVLVVAKFPHMHKYMYSSRVPDE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G016920`
TK1151 ID	TkA06G016920
OH-1004 ID	LXL04_026276
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	94.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA06G016920`
Location	Chr06:4594424-4599111 (-)
Description	Similar to Ormdl1: ORM1-like protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_026276` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006672 ceramide metabolic process Biological Process GO:0010508 positive regulation of autophagy Biological Process GO:0030148 sphingolipid biosynthetic process Biological Process GO:0090156 intracellular sphingolipid homeostasis Biological Process GO:1900060 negative regulation of ceramide biosynthetic process Biological Process GO:1900182 positive regulation of protein localization to nucleus Biological Process GO:2000303 regulation of ceramide biosynthetic process Biological Process GO:0005783 endoplasmic reticulum Cellular Component GO:0005789 endoplasmic reticulum membrane Cellular Component GO:0005886 plasma membrane Cellular Component GO:0017059 serine palmitoyltransferase complex Cellular Component GO:0030667 secretory granule membrane Cellular Component
KEGG gene cross-reference	bta:615368 hsa:94103 mmu:227102 mmu:66612 rno:360618 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.800

Rank 1 · TkA06G016920 · TK1151

Golgi apparatus0.117

Rank 2 · TkA06G016920 · TK1151

Nucleus0.110

Rank 3 · TkA06G016920 · TK1151

Cytoplasm0.102

Rank 4 · TkA06G016920 · TK1151

Cell membrane0.058

Rank 5 · TkA06G016920 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04061ORMDL15-147 aa

PF10864DUF266325-72 aa

PF10864DUF266387-151 aa

PF24673Blr_divisome110-125 aa

PF24673Blr_divisome131-141 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G016920	`PF04061`	ORMDL	15	147	8.8e-51	172.0
TkA06G016920	`PF10864`	DUF2663	25	72	0.16	13.0
TkA06G016920	`PF10864`	DUF2663	87	151	0.16	13.0
TkA06G016920	`PF24673`	Blr_divisome	110	125	0.86	9.9
TkA06G016920	`PF24673`	Blr_divisome	131	141	0.86	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card