TkA06G013370 | RubberDandelionOmics

Gene overview

TkA06G013370

Reference: TK1151 Chr: Chr06 Coordinates: 3495875-3497727 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1208 bp · TkA06G013370|TK1151|cDNA

CGTCGTCAGTTACAGGTCGTCTTCACCGGCCCTTGCTCTCTCTCTGAACCTCCGTCTCTTCTCTCTAAAATCTCCCTTTCTTCTTCACGGCGGCTTGCTGGTACCTCATGCCACCGGAACGGTAGGGTTTTTCAGAAAAGAAGAAGGGGTAGCGTGATATCATCGCCTTACAAGGAGTTCTATCTCACTCTAGGGTTTATGTTTGCTGAAGTTTTCATGTGTTATGAATATCGTCAATGGAGATTTCCTATTCCTTCTCC...

CDS

Download CDS FASTA

1011 bp · TkA06G013370|TK1151|CDS

CGTCGTCAGTTACAGGTCGTCTTCACCGGCCCTTGCTCTCTCTCTGAACCTCCGTCTCTTCTCTCTAAAATCTCCCTTTCTTCTTCACGGCGGCTTGCTGGTACCTCATGCCACCGGAACGGTAGGGTTTTTCAGAAAAGAAGAAGGGGTAGCGTGATATCATCGCCTTACAAGGAGTTCTATCTCACTCTAGGGTTTATGTTTGCTGAAGTTTTCATGTGTTATGAATATCGTCAATGGAGATTTCCTATTCCTTCTCC...

Protein

Download Protein FASTA

336 aa · TkA06G013370|TK1151|PROTEIN

RRQLQVVFTGPCSLSEPPSLLSKISLSSSRRLAGTSCHRNGRVFQKRRRGSVISSPYKEFYLTLGFMFAEVFMCYEYRQWRFPIPSPGFIGGTDSMAVTATARMMNGGGGGGQVVLAERERQQMIGASMMEQLVPEITTHALSYLDYPSLCRLSMTNSSMRRAANDDNAWKALYHKDFTMEQDSVTPANGWKAYYAATRAIVNINQQFFDIIRDRSLPEMGRLWLNADYVKCIHASGELFTGYSGVLGSWQLAFNWEAVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G013370`
TK1151 ID	TkA06G013370
OH-1004 ID	LXL04_005742
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	63.600
Protein coverage (%)	TK1151 71.429 / OH-1004 77.592 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G013370

Location Chr06:3495875-3497727 (-)

Description Similar to SKIP8: F-box protein SKIP8

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g10925`	Component of SCF(ASK-cullin-F-box) E3 ubiquitin ligase complexes, which may mediate the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At4g23960`	Probable F-box protein At4g23960.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_005742 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT4G10925

ath:AT4G23960

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.393

Rank 1 · TkA06G013370 · TK1151

Nucleus0.387

Rank 2 · TkA06G013370 · TK1151

Cell membrane0.114

Rank 3 · TkA06G013370 · TK1151

Plastid0.094

Rank 4 · TkA06G013370 · TK1151

Endoplasmic reticulum0.089

Rank 5 · TkA06G013370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15966F-box_4129-162 aa

PF00646F-box132-171 aa

PF12937F-box-like135-175 aa

PF06881Elongin_A158-199 aa

PF12680SnoaL_2164-203 aa

PF14534DUF4440165-180 aa

PF13474SnoaL_3201-321 aa

PF14534DUF4440204-312 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G013370	`PF15966`	F-box_4	129	162	0.053	14.1
TkA06G013370	`PF00646`	F-box	132	171	2.1e-05	25.0
TkA06G013370	`PF12937`	F-box-like	135	175	4.4e-07	30.3
TkA06G013370	`PF06881`	Elongin_A	158	199	0.18	13.1
TkA06G013370	`PF12680`	SnoaL_2	164	203	0.1	13.9
TkA06G013370	`PF14534`	DUF4440	165	180	0.0029	18.7
TkA06G013370	`PF13474`	SnoaL_3	201	321	2.4e-20	73.8
TkA06G013370	`PF14534`	DUF4440	204	312	0.0029	18.7
TkA06G013370	`PF12680`	SnoaL_2	206	311	0.1	13.9
TkA06G013370	`PF08332`	CaMKII_AD	280	319	0.14	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93YV9`	Arabidopsis thaliana	sp\|Q93YV9\|SKIP8_ARATH F-box protein SKIP8	69.800%	Swiss-Prot	Medium
`Q9T0B0`	Arabidopsis thaliana	sp\|Q9T0B0\|FB335_ARATH Probable F-box protein At4g23960	60.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card