TkA06G010530 | RubberDandelionOmics

Gene overview

TkA06G010530

Reference: TK1151 Chr: Chr06 Coordinates: 2719699-2722691 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2251 bp · TkA06G010530|TK1151|cDNA

CTTCCATATAAAACTACTGGATAGCTCCCTCTTGTTTCCCTTGCAGGTGCCTCAATTCTTCTTCCTTCATCTCCTCTCTCTGTCTCACTCCCACACACAAACACACACACACACACACTTGTCAGTTGCTTCTTTCTATTTTAAATTCCCTTTTCTTTCATAGTTTCATTCCGCCATTAATGGAGGCTGCCCACATGACCCCATTACTATTCATATTTTTCTTGAACCACAAAACCCCCTATTCTATTTATCTTTACATA...

CDS

Download CDS FASTA

1566 bp · TkA06G010530|TK1151|CDS

ATGGCTGCAATGGAAAACTTGAGGCAAAAATTAGCTATGGCTGTCAAAAGCATTCAATGGAGCTATGCCATCTTCTGGTCCATTTCTACAACAGAACCAGGGGTATTAACATGGTGTGATGGGTACTACAATGGAGACATTAAAACACGGAAAACAGTACAAGCAGAAGAAATGAAGGAGGATGACGATGAAGTGGGTTTTCAAAGAACAGAGCAATTAAGACAGCTTTACGAATTGCTTTCAGCCGCCGGTGAACCGCA...

Protein

Download Protein FASTA

521 aa · TkA06G010530|TK1151|PROTEIN

MAAMENLRQKLAMAVKSIQWSYAIFWSISTTEPGVLTWCDGYYNGDIKTRKTVQAEEMKEDDDEVGFQRTEQLRQLYELLSAAGEPQTRRPSAALSPEDLTDAEWYFLVCMTFEFSNGQGLPGRTLANSTTSWLCNAHFADSKVFSRSLLAKSASIQTVACFPYLEGVVEFGITEKVVEDQNIIKKIKAFINDPPPQKILEFPLESCPHILDDDTMLEYDQTLVTNTHNSPKNGCFQSHEQSWQFIDDEEVSVFENNSTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA06G010530`
TK1151 ID	TkA06G010530
OH-1004 ID	LXL04_026444
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 95.010 / OH-1004 97.633 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA06G010530

Location Chr06:2719699-2722691 (-)

Description Similar to BHLH2: Transcription factor EGL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g63650`	Transcription activator, when associated with MYB75/PAP1, MYB90/PAP2 or TT2.	A network of redundant bHLH proteins functions in all TTG1-dependent pathways of Arabidopsis.2003 · DOI: 10.1242/dev.00681 The bHLH genes GLABRA3 (GL3) and ENHANCER OF GLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root.2003 · DOI: 10.1242/dev.00880 The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuit that controls cell patterning in the Arabidopsis root epidermis.2005 · DOI: 10.1242/dev.01565
`At5g41315`	Transcription activator, when associated with MYB75/PAP1, MYB90/PAP2 or TT2.	No verified direct reference in this release
`At4g00480`	Transcription activator, when associated with MYB75/PAP1 or MYB90/PAP2.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026444 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0001708 cell fate specification Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009813 flavonoid biosynthetic process Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0009962 regulation of flavonoid biosynthetic process Biological Process

GO:0010026 trichome differentiation Biological Process

GO:0010091 trichome branching Biological Process

GO:0010214 seed coat development Biological Process

GO:0031542 positive regulation of anthocyanin biosynthetic process Biological Process

GO:0048316 seed development Biological Process

GO:0048629 trichome patterning Biological Process

KEGG gene cross-reference

ath:AT1G63650

ath:AT4G00480

ath:AT4G09820

ath:AT5G41315

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.908

Rank 1 · TkA06G010530 · TK1151

Cytoplasm0.149

Rank 2 · TkA06G010530 · TK1151

Cell membrane0.057

Rank 3 · TkA06G010530 · TK1151

Endoplasmic reticulum0.027

Rank 4 · TkA06G010530 · TK1151

Plastid0.017

Rank 5 · TkA06G010530 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14215bHLH-MYC_N7-189 aa

PF00010HLH68-82 aa

PF00010HLH352-388 aa

PF23173bHLH_SAC51352-391 aa

PF23177bHLH_IRO3352-407 aa

PF00011HSP20428-497 aa

PF22754bHLH-TF_ACT-like_plant439-514 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA06G010530	`PF14215`	bHLH-MYC_N	7	189	1.8e-50	172.5
TkA06G010530	`PF00010`	HLH	68	82	1.1e-06	29.1
TkA06G010530	`PF00010`	HLH	352	388	1.1e-06	29.1
TkA06G010530	`PF23173`	bHLH_SAC51	352	391	1.4e-06	28.8
TkA06G010530	`PF23177`	bHLH_IRO3	352	407	0.00022	22.3
TkA06G010530	`PF00011`	HSP20	428	497	0.013	16.3
TkA06G010530	`PF22754`	bHLH-TF_ACT-like_plant	439	514	1.8e-20	73.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CAD0`	Arabidopsis thaliana	sp\|Q9CAD0\|EGL1_ARATH Transcription factor EGL1	41.700%	Swiss-Prot	Medium
`Q9FN69`	Arabidopsis thaliana	sp\|Q9FN69\|GL3_ARATH Transcription factor GLABRA 3	39.200%	Swiss-Prot	Medium
`Q8W2F1`	Arabidopsis thaliana	sp\|Q8W2F1\|BH012_ARATH Transcription factor MYC1	32.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card