RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G469860
Reference: TK1151 Chr: Chr05 Coordinates: 117741814-117745828 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1942 bp · TkA05G469860|TK1151|cDNA

GAAAGATGCTTCAAAGTGATACTATGTAGAGTTTACGATAAAATCTACCTGATATCAAATTTGATAAAAGATTTGCAGTGATACTGATACGGTTTGAAAGGAGAAAATATATTATCTTTTTACGGCGGGTAAAAGGAAATTTTTAGCAGATTACATCTCAAGAAACCGAGGACACTGCGGCAGGAGGGCTTGGGGGTTTCGAGTGTAGCTGCCTATTTCTGCTCCTTGATTGACACTTGACCGACCAAAAGAAGAATCGC...

CDS

Download CDS FASTA

1344 bp · TkA05G469860|TK1151|CDS

ATGGAGGGTGGCGGTGTGCTGTCTGCTACAGACCAGCAACAAATGGTCTCTTCCTTTCTGGAAATTGCGGTTGGCCAGACCGCCGATACGGCCAGGCAGTTCTTGCAGGCTACAAGCTGGAAGCTTGAAGAAGCCATTCAACTTTTTTACATCGGAAATGAGGCAGGTGCCGCCTCATTACCACCAGATGTCCCGCCTCAAAATGAAGCAGCCATGTCCGACCAAACAAGGGGAGTGTCTGAATTTGAAAATATTAAAGA...

Protein

Download Protein FASTA

447 aa · TkA05G469860|TK1151|PROTEIN

MEGGGVLSATDQQQMVSSFLEIAVGQTADTARQFLQATSWKLEEAIQLFYIGNEAGAASLPPDVPPQNEAAMSDQTRGVSEFENIKENDGSEIRAPLPVKRDVLYDTPMLYGASRMGVSPHATVPFRNFDEELKRAGVWESDQGSTSTAESSRDNLASLYRPPFNLMYHGPFEKAKEAANTQDRWLLVNVQSTREFSSHMLNRDTWANEALAQTITSNFIFWQIYDDTEEGRKISTYYKLDSVPVTLVIDPITGQKMRLW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G469860
TK1151 IDTkA05G469860
OH-1004 IDLXL04_022453
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G469860
LocationChr05:117741814-117745828 (-)
DescriptionSimilar to PUX7: Plant UBX domain-containing protein 7
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g14570 Acts as a bridge between CDC48A and ubiquitin, suggesting a role in targeted protein degradation.
Functional characterization of the plant ubiquitin regulatory X (UBX) domain-containing protein AtPUX7 in Arabidopsis thaliana.2013 · DOI: 10.1016/j.gene.2013.05.056
At4g14250 Putative plant UBX domain-containing protein 14. No verified direct reference in this release
At4g14245 Plant UBX domain-containing protein 16. No verified direct reference in this release
At1g59550 Putative plant UBX domain-containing protein 15. No verified direct reference in this release
At3g23605 Plant UBX domain-containing protein 12. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022453 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0043161 proteasome-mediated ubiquitin-dependent protein catabolic process Biological Process
GO:0005634 nucleus Cellular Component
GO:0005737 cytoplasm Cellular Component
GO:0030674 protein-macromolecule adaptor activity Molecular Function
GO:0043130 ubiquitin binding Molecular Function
KEGG gene cross-reference
ath:AT1G14570
ath:AT1G59550
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.572
Rank 1 · TkA05G469860 · TK1151
Nucleus0.477
Rank 2 · TkA05G469860 · TK1151
Cell membrane0.075
Rank 3 · TkA05G469860 · TK1151
Endoplasmic reticulum0.074
Rank 4 · TkA05G469860 · TK1151
Golgi apparatus0.057
Rank 5 · TkA05G469860 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF22566UBA_811-53 aa
PF14555UBA_413-53 aa
PF29089Protamine-383-104 aa
PF13899Thioredoxin_7172-251 aa
PF03190Thioredox_DsbH173-238 aa
PF13098Thioredoxin_2174-275 aa
PF04696Pinin_SDK_memA268-363 aa
PF02459Adeno_terminal273-324 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G469860PF22566UBA_811532.8e-0627.8
TkA05G469860PF14555UBA_413534.4e-1143.1
TkA05G469860PF29089Protamine-3831040.08813.7
TkA05G469860PF13899Thioredoxin_71722511.1e-1351.8
TkA05G469860PF03190Thioredox_DsbH1732380.1412.8
TkA05G469860PF13098Thioredoxin_21742755.4e-0833.9
TkA05G469860PF04696Pinin_SDK_memA2683630.3211.8
TkA05G469860PF02459Adeno_terminal2733240.3410.1
TkA05G469860PF26777NCAPD3_N2863289.96.6
TkA05G469860PF29089Protamine-32943510.08813.7
TkA05G469860PF14851FAM1762973276.47.3
TkA05G469860PF00789UBX3303485.3e-0833.7
TkA05G469860PF00789UBX3694185.3e-0833.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94JZ8Arabidopsis thalianasp|Q94JZ8|PUX7_ARATH Plant UBX domain-containing protein 757.000%Swiss-ProtHigh
P0DKI4Arabidopsis thalianasp|P0DKI4|PUX14_ARATH Putative plant UBX domain-containing protein 1441.400%Swiss-ProtMedium
P0DKI5Arabidopsis thalianasp|P0DKI5|PUX16_ARATH Plant UBX domain-containing protein 1633.700%Swiss-ProtMedium
Q94HV8Arabidopsis thalianasp|Q94HV8|PUX15_ARATH Putative plant UBX domain-containing protein 1539.200%Swiss-ProtMedium
Q9LUG7Arabidopsis thalianasp|Q9LUG7|PUX12_ARATH Plant UBX domain-containing protein 1251.500%Swiss-ProtLow

JBrowse

View in Genome Browser