TkA05G465290 | RubberDandelionOmics

Gene overview

TkA05G465290

Reference: TK1151 Chr: Chr05 Coordinates: 116616631-116623103 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4758 bp · TkA05G465290|TK1151|cDNA

GGACATTTGAACAATTCGATATTTACATCAGTAATGACGTGATTGAATATTATTAAATTTGTATTAATATATACTTTTTTATATAATAACTCAAGATTGACAAATATTTATTAGTAGAATTTGAATGTTGATTAAAAAAAAGGATTGATTCGAATGGCGGGGAGACACCAACAATATGGCGGGGAGTAATAGCAGGAGTGGCGAATCGACGTGCGAATCGGTTTGTCAACTGCGCCACGACAGAACACCGGTTAAGCATG...

CDS

Download CDS FASTA

3345 bp · TkA05G465290|TK1151|CDS

ATGGATTCAGCCGAAACGTCTACAAGCAATAACTGTAGTACGAGATCTGATAACATGCCTGGTGTTGCAGCTCGTAATGGCAATATTGATCAAGTCGATGATGAGTATTCACCGTACGGTCTCACTCCTCCTTCATTGATGGATAAAAAACCTTCCATGGATGATAAAGATGCGAATCCATCTGTTTCTCCTCTGACTTCACGTGGCTGGGATGATATCTCCGTGTACAATGCAAAGAAGAAACAGCATGCTTGGTATGA...

Protein

Download Protein FASTA

1114 aa · TkA05G465290|TK1151|PROTEIN

MDSAETSTSNNCSTRSDNMPGVAARNGNIDQVDDEYSPYGLTPPSLMDKKPSMDDKDANPSVSPLTSRGWDDISVYNAKKKQHAWYEAPDGNWELANIISVSGTESLISFAEGKVCKVQSDILLPANPEILDGVDDLMQLSYLSEPSVLYNLQYRYDRDMIYSKAGPVLVAINPFKNIPLYGKDYIAGYKRKKIGQPHVYAIADTAIREMIRDEVNQAIVISGESGAGKTETAKIAMQYLATVRGGSGIEYEILKTNPIL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G465290`
TK1151 ID	TkA05G465290
OH-1004 ID	LXL04_022410
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.900
Protein coverage (%)	TK1151 99.372 / OH-1004 53.107 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G465290

Location Chr05:116616631-116623103 (+)

Description Similar to VIII-1: Myosin-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g19960`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At1g50360`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At5g54280`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At4g27370`	Myosin heavy chain that is required for the cell cycle-regulated transport of various organelles and proteins for their segregation.	No verified direct reference in this release
`At5g43900`	Myosin heavy chain that is required for the cell cycle- regulated transport of various organelles and proteins for their segregation.	Peroxisomal localization of a myosin XI isoform in Arabidopsis thaliana.2005 · DOI: 10.1093/pcp/pci085 Two class XI myosins function in organelle trafficking and root hair development in Arabidopsis.2008 · DOI: 10.1104/pp.107.113654 A comparative study of the involvement of 17 Arabidopsis myosin family members on the motility of Golgi and other organelles.2009 · DOI: 10.1104/pp.109.136853 Myosin XIK is a major player in cytoplasm dynamics and is regulated by two amino acids in its tail.2012 · DOI: 10.1093/jxb/err265

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022410 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006897 endocytosis Biological Process

GO:0007015 actin filament organization Biological Process

GO:0010082 regulation of root meristem growth Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0030048 actin filament-based movement Biological Process

GO:0048467 gynoecium development Biological Process

GO:0048767 root hair elongation Biological Process

GO:0051645 Golgi localization Biological Process

GO:0051646 mitochondrion localization Biological Process

GO:0060151 peroxisome localization Biological Process

GO:0090436 leaf pavement cell development Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G50360

ath:AT3G19960

ath:AT4G27370

ath:AT5G43900

ath:AT5G54280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.431

Rank 1 · TkA05G465290 · TK1151

Nucleus0.211

Rank 2 · TkA05G465290 · TK1151

Cell membrane0.200

Rank 3 · TkA05G465290 · TK1151

Plastid0.194

Rank 4 · TkA05G465290 · TK1151

Peroxisome0.064

Rank 5 · TkA05G465290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25369SH3_VIII-1_N83-126 aa

PF00063Myosin_head134-792 aa

PF06414Zeta_toxin212-241 aa

PF20720nSTAND3215-242 aa

PF13401AAA_22216-238 aa

PF00612IQ810-825 aa

PF13401AAA_22821-858 aa

PF00612IQ835-849 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G465290	`PF25369`	SH3_VIII-1_N	83	126	4.9e-18	64.9
TkA05G465290	`PF00063`	Myosin_head	134	792	1.2e-232	774.7
TkA05G465290	`PF06414`	Zeta_toxin	212	241	0.025	14.7
TkA05G465290	`PF20720`	nSTAND3	215	242	0.029	14.8
TkA05G465290	`PF13401`	AAA_22	216	238	0.47	11.5
TkA05G465290	`PF00612`	IQ	810	825	4.8e-10	39.0
TkA05G465290	`PF13401`	AAA_22	821	858	0.47	11.5
TkA05G465290	`PF00612`	IQ	835	849	4.8e-10	39.0
TkA05G465290	`PF00612`	IQ	857	876	4.8e-10	39.0
TkA05G465290	`PF00612`	IQ	880	896	4.8e-10	39.0
TkA05G465290	`PF05557`	MAD	919	984	0.036	13.2
TkA05G465290	`PF13401`	AAA_22	925	951	0.47	11.5
TkA05G465290	`PF15035`	Rootletin	925	1110	0.8	10.4
TkA05G465290	`PF26583`	Spectrin_YLPM1	947	985	0.34	11.6
TkA05G465290	`PF26583`	Spectrin_YLPM1	1057	1074	0.34	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LHE9`	Arabidopsis thaliana	sp\|Q9LHE9\|MYO1_ARATH Myosin-1	70.300%	Swiss-Prot	High
`F4I507`	Arabidopsis thaliana	sp\|F4I507\|MYO3_ARATH Myosin-3	68.700%	Swiss-Prot	High
`F4K0A6`	Arabidopsis thaliana	sp\|F4K0A6\|MYO2_ARATH Myosin-2	53.500%	Swiss-Prot	High
`F4JIU4`	Arabidopsis thaliana	sp\|F4JIU4\|MYO4_ARATH Myosin-4	51.600%	Swiss-Prot	High
`Q9LKB9`	Arabidopsis thaliana	sp\|Q9LKB9\|MYO6_ARATH Myosin-6	42.900%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card