TkA05G464670 | RubberDandelionOmics

Gene overview

TkA05G464670

Reference: TK1151 Chr: Chr05 Coordinates: 116393211-116394312 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

815 bp · TkA05G464670|TK1151|cDNA

CTTCAATCTCAGCCAATGCAAATTTATTGTCAAGCTTTTGACCTTTTTATTTCAACGCACGTTGATCGATATCTATGCATTGTTGCATCAAAAACTGGAATCATCACTGTGGACCTGTATATTCGCGCCTCACATTTCCCGCCACAATACTCCAGAAAACCCCTGTGTTCTTCGCTAATTCTAACCACGAAATGGCTTCCACGAAAGCCATAACTGATTTCTTTCCACCGGCAAAACGCTCCAAAGTAGCGGCGGCAGCC...

CDS

Download CDS FASTA

741 bp · TkA05G464670|TK1151|CDS

ATGCATTGTTGCATCAAAAACTGGAATCATCACTGTGGACCTGTATATTCGCGCCTCACATTTCCCGCCACAATACTCCAGAAAACCCCTGTGTTCTTCGCTAATTCTAACCACGAAATGGCTTCCACGAAAGCCATAACTGATTTCTTTCCACCGGCAAAACGCTCCAAAGTAGCGGCGGCAGCCTCGTCTTTGGAGCCTCCTTTGAAAAAAAGAAGCTTCCTTCCGGTTTCCCAAAAATCCACTCCATCTACCACACC...

Protein

Download Protein FASTA

247 aa · TkA05G464670|TK1151|PROTEIN

MHCCIKNWNHHCGPVYSRLTFPATILQKTPVFFANSNHEMASTKAITDFFPPAKRSKVAAAASSLEPPLKKRSFLPVSQKSTPSTTPKSLDDDGVQLSPSSDLNEEQKLRAQFNQSLAKAKRNLKICAARVSKSTSGDGSGRGSLKLEELLVEETWVEALPGEFQKPYAKKLSEFVESEIHGPTPIFPPQHLIFNALNSTPFDNVKAVIIGQDPYHGPGQAMGLSFSVPEGIKVPSSLVNIYKELQQ

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G464670`
TK1151 ID	TkA05G464670
OH-1004 ID	LXL04_022395
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.000
Protein coverage (%)	TK1151 100.000 / OH-1004 66.846 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G464670

Location Chr05:116393211-116394312 (-)

Description Similar to UNG: Uracil-DNA glycosylase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g18630`	Excises uracil residues from the DNA which can arise as a result of misincorporation of dUMP residues by DNA polymerase or due to deamination of cytosine.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022395 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006281 DNA repair Biological Process

GO:0006284 base-excision repair Biological Process

GO:0097510 base-excision repair, AP site formation via deaminated base removal Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004844 uracil DNA N-glycosylase activity Molecular Function

KEGG gene cross-reference

ath:AT3G18630

avn:Avin_13610

ppf:Pput_4308

ppg:PputGB1_4397

ppu:PP_1413

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.887

Rank 1 · TkA05G464670 · TK1151

Cytoplasm0.184

Rank 2 · TkA05G464670 · TK1151

Mitochondrion0.028

Rank 3 · TkA05G464670 · TK1151

Cell membrane0.021

Rank 4 · TkA05G464670 · TK1151

Plastid0.019

Rank 5 · TkA05G464670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

No result was found for this query.

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LIH6`	Arabidopsis thaliana	sp\|Q9LIH6\|UNG_ARATH Uracil-DNA glycosylase, mitochondrial	54.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card