TkA05G461390 | RubberDandelionOmics

Gene overview

TkA05G461390

Reference: TK1151 Chr: Chr05 Coordinates: 115559215-115564464 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3459 bp · TkA05G461390|TK1151|cDNA

ATGAGACACATGGGGTTCGGTTGTGTGTGGAGAAACTGGATTCGCGTGTGCCTCGAGTCCTCCTTCATGTCGATCCTTGTTAACGGATCCCCTACAAATGAGTTCGCGATGGAACGGGGACTTAGACAAGGAGACCCGATCTCTCCATTTCTCTTCACTCTGATTATGGAGGGCCTGAATTTAGCACTTACCAAGGCAAAGCACAACGGAAATTTCAAAGGTATAGACTTGGGTAGTGGGGATCTTTCTATCTCACACTT...

CDS

Download CDS FASTA

3459 bp · TkA05G461390|TK1151|CDS

ATGAGACACATGGGGTTCGGTTGTGTGTGGAGAAACTGGATTCGCGTGTGCCTCGAGTCCTCCTTCATGTCGATCCTTGTTAACGGATCCCCTACAAATGAGTTCGCGATGGAACGGGGACTTAGACAAGGAGACCCGATCTCTCCATTTCTCTTCACTCTGATTATGGAGGGCCTGAATTTAGCACTTACCAAGGCAAAGCACAACGGAAATTTCAAAGGTATAGACTTGGGTAGTGGGGATCTTTCTATCTCACACTT...

Protein

Download Protein FASTA

1152 aa · TkA05G461390|TK1151|PROTEIN

MRHMGFGCVWRNWIRVCLESSFMSILVNGSPTNEFAMERGLRQGDPISPFLFTLIMEGLNLALTKAKHNGNFKGIDLGSGDLSISHLFFADDAIFMGEWTFDNAVNIISILHCFRRVSGLSVNYNKSSLFGMGVPQEEVRAMATVLRCKPDSFPVVFLGIPIGKSMKRIAHWSPLIEKFKKKLSNWKIKTLSIGGRLTIVKNILGNMGSYWFSLFPVPKTIINTLEALRRNFLWGIPIGERGINWIKWDKICSRIDKGGL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G461390`
TK1151 ID	TkA05G461390
OH-1004 ID	LXL04_009233
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	49.800
Protein coverage (%)	TK1151 51.910 / OH-1004 52.414 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G461390

Location Chr05:115559215-115564464 (-)

Description Similar to HDR1: Protein HEADING DATE REPRESSOR 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: P92555`	Uncharacterized mitochondrial protein AtMg01250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009233 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0009908 flower development Biological Process

GO:0009909 regulation of flower development Biological Process

GO:0032197 retrotransposition Biological Process

GO:0090304 nucleic acid metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003723 RNA binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function

GO:0009036 type II site-specific deoxyribonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

dosa:Os02g0793900

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.597

Rank 1 · TkA05G461390 · TK1151

Cytoplasm0.350

Rank 2 · TkA05G461390 · TK1151

Cell membrane0.079

Rank 3 · TkA05G461390 · TK1151

Endoplasmic reticulum0.046

Rank 4 · TkA05G461390 · TK1151

Plastid0.026

Rank 5 · TkA05G461390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00078RVT_111-159 aa

PF05641Agenet143-159 aa

PF13966zf-RVT450-517 aa

PF05641Agenet683-742 aa

PF02992Transposase_21798-837 aa

PF02992Transposase_21842-964 aa

PF13960DUF42181026-1060 aa

PF13960DUF42181059-1097 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G461390	`PF00078`	RVT_1	11	159	4.8e-10	40.4
TkA05G461390	`PF05641`	Agenet	143	159	9.9e-09	36.3
TkA05G461390	`PF13966`	zf-RVT	450	517	1.9e-16	61.2
TkA05G461390	`PF05641`	Agenet	683	742	9.9e-09	36.3
TkA05G461390	`PF02992`	Transposase_21	798	837	1.9e-49	168.5
TkA05G461390	`PF02992`	Transposase_21	842	964	1.9e-49	168.5
TkA05G461390	`PF13960`	DUF4218	1026	1060	6.8e-15	55.6
TkA05G461390	`PF13960`	DUF4218	1059	1097	6.8e-15	55.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92555`	Arabidopsis thaliana	sp\|P92555\|M1250_ARATH Uncharacterized mitochondrial protein AtMg01250	35.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card