TkA05G455950 | RubberDandelionOmics

Gene overview

TkA05G455950

Reference: TK1151 Chr: Chr05 Coordinates: 114213982-114215678 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

775 bp · TkA05G455950|TK1151|cDNA

GTAAAAATTGTGTATGAGTGAAAATTGTGGCGCGATAGCCTGTTCATCGTTGATAATAAAAAAATCGCCAACGTTGATTCTGATTACTGCCTTCTTCATCGATCATTAAAAACTCTAATAGCGATTATTCTTCTTCGTCGATCATCAGGCTCGATTTTTAGAAATGACTGAACCAACTTCAAGTAACATCGAGGATGACAACATGGCCCTAGAGTACAACACCAACAATGTCAAAAAGGCAAAACTAAACTCAACACTAT...

CDS

Download CDS FASTA

534 bp · TkA05G455950|TK1151|CDS

ATGACTGAACCAACTTCAAGTAACATCGAGGATGACAACATGGCCCTAGAGTACAACACCAACAATGTCAAAAAGGCAAAACTAAACTCAACACTATCTGCACTTCTTAATGATCCTGTTCTTTCAGATGTACCAAAAAATCCAACTTTATCAGATGTTGATACCCTAATCAGTTTGGAACTCGGGAGTGCCATGCGTGTTTCCGTAATTAAAATGGATAACACATCTTTTGATGTGGCAGTGATGAATTCAGCAAAAGT...

Protein

Download Protein FASTA

177 aa · TkA05G455950|TK1151|PROTEIN

MTEPTSSNIEDDNMALEYNTNNVKKAKLNSTLSALLNDPVLSDVPKNPTLSDVDTLISLELGSAMRVSVIKMDNTSFDVAVMNSAKVKDLKLAVEKKVNEMEQSKMGHRHISWKHVWRNFCLSYHNEKLLNDDGILQDHGVRNHSQVHFLPYVMTRESNRHSRRRKHRFFHGLNRRE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G455950`
TK1151 ID	TkA05G455950
OH-1004 ID	LXL04_022278
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 65.556 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G455950

Location Chr05:114213982-114215678 (+)

Description Similar to SNRNP25: U11/U12 small nuclear ribonucleoprotein 25 kDa protein

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g07860`	U11/U12 small nuclear ribonucleoprotein 25 kDa protein.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022278 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000388 spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0008380 RNA splicing Biological Process

GO:0009733 response to auxin Biological Process

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005689 U12-type spliceosomal complex Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT3G07860

ath:AT5G18030

bta:513526

hsa:79622

mmu:78372

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.510

Rank 1 · TkA05G455950 · TK1151

Nucleus0.327

Rank 2 · TkA05G455950 · TK1151

Cell membrane0.212

Rank 3 · TkA05G455950 · TK1151

Lysosome / Vacuole0.070

Rank 4 · TkA05G455950 · TK1151

Golgi apparatus0.054

Rank 5 · TkA05G455950 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08817YukD43-58 aa

PF18036Ubiquitin_450-153 aa

PF07738Sad1_UNC51-110 aa

PF23326UBL_UBAC162-144 aa

PF08817YukD65-143 aa

PF00240ubiquitin70-98 aa

PF00240ubiquitin126-149 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G455950	`PF08817`	YukD	43	58	0.057	14.9
TkA05G455950	`PF18036`	Ubiquitin_4	50	153	4.3e-35	120.6
TkA05G455950	`PF07738`	Sad1_UNC	51	110	0.13	13.1
TkA05G455950	`PF23326`	UBL_UBAC1	62	144	0.0079	16.8
TkA05G455950	`PF08817`	YukD	65	143	0.057	14.9
TkA05G455950	`PF00240`	ubiquitin	70	98	0.0048	17.3
TkA05G455950	`PF00240`	ubiquitin	126	149	0.0048	17.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84WS8`	Arabidopsis thaliana	sp\|Q84WS8\|U1125_ARATH U11/U12 small nuclear ribonucleoprotein 25 kDa protein	68.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card