TkA05G454080 | RubberDandelionOmics

Gene overview

TkA05G454080

Reference: TK1151 Chr: Chr05 Coordinates: 113665103-113668018 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2250 bp · TkA05G454080|TK1151|cDNA

ATGTATCCAACTCACTTTATTTTCTTACTTTTCAGTCTACTCATCTATGCTTTCCCATCTCCGTCAACCGCCGATTATTTGATTGGAGTTGGAAGCTACGACAGTACAGGTCCAGCTGCCGGAGTCAACATGATGGGGTATGCAAATCTACAACAAAACACCGCCGGAATACATTTCCGGCTAAGAGCACGAGCGTTCATTGTAGCTGAGAGCTCCGGCGGCCCAAGAATTGCGTTCGTTAATCTTGACGCTGGAATGGC...

CDS

Download CDS FASTA

2250 bp · TkA05G454080|TK1151|CDS

ATGTATCCAACTCACTTTATTTTCTTACTTTTCAGTCTACTCATCTATGCTTTCCCATCTCCGTCAACCGCCGATTATTTGATTGGAGTTGGAAGCTACGACAGTACAGGTCCAGCTGCCGGAGTCAACATGATGGGGTATGCAAATCTACAACAAAACACCGCCGGAATACATTTCCGGCTAAGAGCACGAGCGTTCATTGTAGCTGAGAGCTCCGGCGGCCCAAGAATTGCGTTCGTTAATCTTGACGCTGGAATGGC...

Protein

Download Protein FASTA

749 aa · TkA05G454080|TK1151|PROTEIN

MYPTHFIFLLFSLLIYAFPSPSTADYLIGVGSYDSTGPAAGVNMMGYANLQQNTAGIHFRLRARAFIVAESSGGPRIAFVNLDAGMASQLVTIKVLERLSKRFGKLYNEDNVAISGTHTHAGPGGYMQYVVYSVTSLGFIPQSFDAIVTAIEMSIVQAHQNLKPGSIAINTGDLDNAGVNRSPSAYLFNPPDERARYPRNVDTLMTLLKFVDGTSQRSIGAFTWFATHGTSMSKDNTLISGDNKGAAARFFEDWFTSTVT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G454080`
TK1151 ID	TkA05G454080
OH-1004 ID	LXL04_022260
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G454080

Location Chr05:113665103-113668018 (+)

Description Similar to NCER2: Neutral ceramidase 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38010`	Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid.	No verified direct reference in this release
`At1g07380`	Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid.	An Arabidopsis neutral ceramidase mutant ncer1 accumulates hydroxyceramides and is sensitive to oxidative stress.2015 · DOI: 10.3389/fpls.2015.00460
`At5g58980`	Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid (By similarity).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0624000`	Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022260 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006672 ceramide metabolic process Biological Process

GO:0034599 cellular response to oxidative stress Biological Process

GO:0042759 long-chain fatty acid biosynthetic process Biological Process

GO:0046512 sphingosine biosynthetic process Biological Process

GO:0046514 ceramide catabolic process Biological Process

GO:0090156 intracellular sphingolipid homeostasis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT1G07380

ath:AT2G38010

ath:AT5G58980

ddi:DDB_G0268374

dosa:Os01g0624000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Lysosome / Vacuole0.271

Rank 1 · TkA05G454080 · TK1151

Extracellular0.252

Rank 2 · TkA05G454080 · TK1151

Cytoplasm0.207

Rank 3 · TkA05G454080 · TK1151

Endoplasmic reticulum0.193

Rank 4 · TkA05G454080 · TK1151

Cell membrane0.115

Rank 5 · TkA05G454080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04734Ceramidase_alk26-581 aa

PF20009GEVED529-556 aa

PF17048Ceramidse_alk_C583-748 aa

PF20009GEVED694-724 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G454080	`PF04734`	Ceramidase_alk	26	581	1.4e-219	730.7
TkA05G454080	`PF20009`	GEVED	529	556	0.057	14.9
TkA05G454080	`PF17048`	Ceramidse_alk_C	583	748	1.2e-37	130.0
TkA05G454080	`PF20009`	GEVED	694	724	0.057	14.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q304B9`	Arabidopsis thaliana	sp\|Q304B9\|NCER2_ARATH Neutral ceramidase 2	59.700%	Swiss-Prot	High
`F4HQM3`	Arabidopsis thaliana	sp\|F4HQM3\|NCER1_ARATH Neutral ceramidase 1	56.600%	Swiss-Prot	High
`F4KHQ8`	Arabidopsis thaliana	sp\|F4KHQ8\|NCER3_ARATH Neutral ceramidase 3	55.000%	Swiss-Prot	High
`Q0JL46`	Oryza sativa subsp. japonica	sp\|Q0JL46\|NCASE_ORYSJ Neutral ceramidase	57.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card