TkA05G451070 | RubberDandelionOmics

Gene overview

TkA05G451070

Reference: TK1151 Chr: Chr05 Coordinates: 112838872-112844721 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5258 bp · TkA05G451070|TK1151|cDNA

GGATTTAATCATAAATACGAGTTCGAATTGGTGAGAGAGACGTGAAGAAACAGGGCCAAAAGGTTTTTCTTTTTCCCCGCCAGCTGTTCCGTTTCAGCAAACTCTGTGTGTGTGTGTGTGTGTGTGCGTGAGAAATTTTAGAGAGAGAATCTAGAGAGAGAGAGGGAGATCTCCCGCCCCAATCTCCTCCTCCCCTTCACCTCTCTACTCTTTCGAATAATTCGGCATTCTCATAAACCCCAACCTAGTTTATAATCTCA...

CDS

Download CDS FASTA

4551 bp · TkA05G451070|TK1151|CDS

ATGACGGCTGGTACTGAGGTAGTTTGTAGCGATGTCGTTCGGAAGGTTGAAAGTGAGGAGAAGTGTATAGCTGGTTTGGATACGCGTGATCTGAACGAAGTCGGTGATGCTGGTACTGTTCACGATAATGTCGGTGGAAACGGAAACAGCAATGTCGGTGGCAACGGGAAGGACGATAACGATGATTCTTCCTATGTGTTTGTTAGCGGTAGTATTGAGGTGGCTTCTGCTGATCCTGCTGATAAGGTAGATGTTAATGT...

Protein

Download Protein FASTA

1516 aa · TkA05G451070|TK1151|PROTEIN

MTAGTEVVCSDVVRKVESEEKCIAGLDTRDLNEVGDAGTVHDNVGGNGNSNVGGNGKDDNDDSSYVFVSGSIEVASADPADKVDVNVDAISPKSDWSDEVDQFQKEKLGIENGGIPVDPLGLETNGIANGSATVGDSDVKADKDEVNLENGSTVDPPVLLESNGIAHDVNGHPDKNTGEEEQVVESTEVNDADEITNVEAKMDDIVSEITVDPGSTLNPIESSQVTVIESESIKEPESQVTITQSVSTPDPVNTTDESLC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G451070`
TK1151 ID	TkA05G451070
OH-1004 ID	LXL04_035458
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	34.500
Protein coverage (%)	TK1151 25.792 / OH-1004 38.987 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G451070

Location Chr05:112838872-112844721 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g27500`	Promotes AHA1 plasma membrane ATPase activity by binding to a site different from the 14-3-3 binding site.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035458 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.484

Rank 1 · TkA05G451070 · TK1151

Nucleus0.258

Rank 2 · TkA05G451070 · TK1151

Cell membrane0.254

Rank 3 · TkA05G451070 · TK1151

Endoplasmic reticulum0.096

Rank 4 · TkA05G451070 · TK1151

Golgi apparatus0.086

Rank 5 · TkA05G451070 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28572PPI_helical964-1251 aa

PF27883PPI_C1003-1014 aa

PF28572PPI_helical1334-1370 aa

PF27883PPI_C1353-1388 aa

PF27883PPI_C1390-1403 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G451070	`PF28572`	PPI_helical	964	1251	1e-16	62.0
TkA05G451070	`PF27883`	PPI_C	1003	1014	1.8e-10	41.4
TkA05G451070	`PF28572`	PPI_helical	1334	1370	1e-16	62.0
TkA05G451070	`PF27883`	PPI_C	1353	1388	1.8e-10	41.4
TkA05G451070	`PF27883`	PPI_C	1390	1403	1.8e-10	41.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23144`	Arabidopsis thaliana	sp\|O23144\|PPI1_ARATH Proton pump-interactor 1	22.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card