RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G450370
Reference: TK1151 Chr: Chr05 Coordinates: 112607577-112611147 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2721 bp · TkA05G450370|TK1151|cDNA

AAATTAGAAAGAGACCTATATTTTCCTTGCATGTTTTGCTAACTTAAATCAATCTTTTTACCTTCACCTAATTTAATACAAGTTTTAGATTTTTTAATTTGTTCCATTTTCTTGATATCCCCATGTGAGAAAGCTACAGGAGAACGGCAGGACAGCTTGCGATTTCAAGGAGGAGCGACCTCCATAACCATCTTCAACAATGAGTTCGGTGACGCTTTCCCCAGCTTCGACTACATCACCGGGAAACCCATCTGGTTTCT...

CDS

Download CDS FASTA

2163 bp · TkA05G450370|TK1151|CDS

ATGAGTTCGGTGACGCTTTCCCCAGCTTCGACTACATCACCGGGAAACCCATCTGGTTTCTATCGGAATAGGAGGACGGCGAGGACCACTAACATCATCCCTAAATGTCGGACTAGATTCAGGGGGAAACCCTTATCTGCAGCGCTGGTTGAGGAAGCGAGACCTCGCGCTTTGCCTCCGGCTAGAAGTAATAACAATATTAACGGTGCCGGCGGAGAAGCAAACCTCTCTTCCATAGTTCTGGCGAAGGATAGAGCAGA...

Protein

Download Protein FASTA

720 aa · TkA05G450370|TK1151|PROTEIN

MSSVTLSPASTTSPGNPSGFYRNRRTARTTNIIPKCRTRFRGKPLSAALVEEARPRALPPARSNNNINGAGGEANLSSIVLAKDRADDIQAESKALARASNASVYSPELLQNKYASRPFKVLQRTLQIVVGLGSFGLKLWIDQLQGQLVQNRRSRAIELRETFTRLGPTFVKLGQGLSTRPDLCPPEFLEELSELQDALPTFPDAEAFACIEKELGIPLDSIYTSISTSPIAAASLGQVYKAKLKKSGQLVAVKVQRPGI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G450370
TK1151 IDTkA05G450370
OH-1004 IDLXL04_022203
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.200
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G450370
LocationChr05:112607577-112611147 (+)
DescriptionSimilar to ABC1K3: Protein ACTIVITY OF BC1 COMPLEX KINASE 3, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g79600 Kinase that can phosphorylate the tocopherol cyclase VTE1, a key enzyme of tocopherol (vitamin E) metabolism and involved in the recycling of oxidated alpha-tocopherol quinone, possibly stabilizing it at plastoglobules.
A chloroplast ABC1-like kinase regulates vitamin E metabolism in Arabidopsis.2013 · DOI: 10.1104/pp.113.218644
Loss of plastoglobule kinases ABC1K1 and ABC1K3 causes conditional degreening, modified prenyl-lipids, and recruitment of the jasmonic acid pathway.2013 · DOI: 10.1105/tpc.113.111120
At1g71810 Uncharacterized aarF domain-containing protein kinase At1g71810, chloroplastic. No verified direct reference in this release
At4g31390 Kinase that can phosphorylate the tocopherol cyclase VTE1, a key enzyme of tocopherol (vitamin E) metabolism and involved in the recycling of oxidated alpha-tocopherol quinone, possibly stabilizing it at plastoglobules.
AtACDO1, an ABC1-like kinase gene, is involved in chlorophyll degradation and the response to photooxidative stress in Arabidopsis.2012 · DOI: 10.1093/jxb/ers072
Loss of plastoglobule kinases ABC1K1 and ABC1K3 causes conditional degreening, modified prenyl-lipids, and recruitment of the jasmonic acid pathway.2013 · DOI: 10.1105/tpc.113.111120
ABC1K1/PGR6 kinase: a regulatory link between photosynthetic activity and chloroplast metabolism.2014 · DOI: 10.1111/tpj.12385

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_022203 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006995 cellular response to nitrogen starvation Biological Process
GO:0009414 response to water deprivation Biological Process
GO:0009637 response to blue light Biological Process
GO:0009644 response to high light intensity Biological Process
GO:0009658 chloroplast organization Biological Process
GO:0009767 photosynthetic electron transport chain Biological Process
GO:0010027 thylakoid membrane organization Biological Process
GO:0010109 regulation of photosynthesis Biological Process
GO:0010114 response to red light Biological Process
GO:0015996 chlorophyll catabolic process Biological Process
GO:0031540 regulation of anthocyanin biosynthetic process Biological Process
GO:0050821 protein stabilization Biological Process
KEGG gene cross-reference
ath:AT1G71810
ath:AT1G79600
ath:AT4G31390
syn:sll0005
syn:slr1919
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.989
Rank 1 · TkA05G450370 · TK1151
Mitochondrion0.020
Rank 2 · TkA05G450370 · TK1151
Cytoplasm0.013
Rank 3 · TkA05G450370 · TK1151
Peroxisome0.013
Rank 4 · TkA05G450370 · TK1151
Cell membrane0.012
Rank 5 · TkA05G450370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01636APH86-111 aa
PF03109ABC192-112 aa
PF03109ABC1195-438 aa
PF00069Pkinase237-417 aa
PF30507ABC1K3_C287-306 aa
PF01636APH308-352 aa
PF06176WaaY332-397 aa
PF01636APH380-421 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G450370PF01636APH861110.0002221.8
TkA05G450370PF03109ABC1921124.9e-75252.6
TkA05G450370PF03109ABC11954384.9e-75252.6
TkA05G450370PF00069Pkinase2374170.004317.2
TkA05G450370PF30507ABC1K3_C2873066.8e-30104.6
TkA05G450370PF01636APH3083520.0002221.8
TkA05G450370PF06176WaaY3323970.007916.6
TkA05G450370PF01636APH3804210.0002221.8
TkA05G450370PF27536UbiB_helical4595190.0003520.8
TkA05G450370PF30507ABC1K3_C5927096.8e-30104.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9MA15Arabidopsis thalianasp|Q9MA15|AB1K3_ARATH Protein ACTIVITY OF BC1 COMPLEX KINASE 3, chloroplastic79.200%Swiss-ProtHigh
Q94BU1Arabidopsis thalianasp|Q94BU1|Y1181_ARATH Uncharacterized aarF domain-containing protein kinase At1g71810, chloroplastic39.800%Swiss-ProtMedium
Q8RWG1Arabidopsis thalianasp|Q8RWG1|AB1K1_ARATH Protein ACTIVITY OF BC1 COMPLEX KINASE 1, chloroplastic40.000%Swiss-ProtMedium

JBrowse

View in Genome Browser