TkA05G447760 | RubberDandelionOmics

Gene overview

TkA05G447760

Reference: TK1151 Chr: Chr05 Coordinates: 111976902-111979828 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2578 bp · TkA05G447760|TK1151|cDNA

ACCATTGCCTTCAACATTCTCCATTCAAACGCCTCCACCTCCTAATTTCCTTGCTCTTACATAGATCCACCTGCTACTTGTTTCTTCCTCTGTTTCCTTCTTAAACAATTATAGTCTCTTACACCCACCATTTTTTTCTTCTCCGCTCATCACACATATCTTATTCTTTCCCTCAACAGCTAACGACAATCCTTACAAATTACCACCTCACTGATTTTGATACTCAATCTTATGGTGGTAAGGTCTACTCACTTTAATCA...

CDS

Download CDS FASTA

744 bp · TkA05G447760|TK1151|CDS

ATGGGGGTTGGATTATCTATTCTAATCGGCTTGAAATCAGCTACTCTATTCACAATTTTCGCATATATAAGATTCCTAGGGTTTACTTTACTGTCAGTACCCTTCTTGTACGCATCTCTAGTATCATTGCTCGTATCTCTCGCTTCACACCCTACAATCAATGTTCCATTCCTTTTGGGTAAAAACACCGATGGATCGTTCCCAATTTGGTCTCTACTCATGTTCAGCCCTTACTTATATTTCGTCCGAGGGTTTTCAGC...

Protein

Download Protein FASTA

247 aa · TkA05G447760|TK1151|PROTEIN

MGVGLSILIGLKSATLFTIFAYIRFLGFTLLSVPFLYASLVSLLVSLASHPTINVPFLLGKNTDGSFPIWSLLMFSPYLYFVRGFSALRRLKSREAPYTEVSKGLYVGGWPSSPEQMPPGNPAIIDCTCELPRVFGLSKNGYLCVPTWDTRSPDPGAMESAVRWALRKRTTSTPIFIHCAYGHGRSVAVMCALLVTLGVVDDWKNAERLIREKRPYIRMNALHRKALEEWSKDRLILSPPKNGSNAR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G447760`
TK1151 ID	TkA05G447760
OH-1004 ID	LXL04_022152
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G447760`
Location	Chr05:111976902-111979828 (-)
Description	Similar to ynbD: Uncharacterized protein YnbD (Escherichia coli (strain K12)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_022152` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005886 plasma membrane Cellular Component GO:0004721 phosphoprotein phosphatase activity Molecular Function
KEGG gene cross-reference	ecj:JW1408 eco:b1411 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.334

Rank 1 · TkA05G447760 · TK1151

Mitochondrion0.316

Rank 2 · TkA05G447760 · TK1151

Cytoplasm0.115

Rank 3 · TkA05G447760 · TK1151

Nucleus0.076

Rank 4 · TkA05G447760 · TK1151

Plastid0.069

Rank 5 · TkA05G447760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02907Peptidase_S29116-201 aa

PF00782DSPc123-232 aa

PF14566PTPlike_phytase142-193 aa

PF22785Tc-R-P143-198 aa

PF22784PTP-SAK144-203 aa

PF00102Y_phosphatase155-198 aa

PF04179Init_tRNA_PT161-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G447760	`PF02907`	Peptidase_S29	116	201	0.13	12.7
TkA05G447760	`PF00782`	DSPc	123	232	5.6e-08	33.4
TkA05G447760	`PF14566`	PTPlike_phytase	142	193	0.035	14.9
TkA05G447760	`PF22785`	Tc-R-P	143	198	0.00064	20.9
TkA05G447760	`PF22784`	PTP-SAK	144	203	0.0001	23.1
TkA05G447760	`PF00102`	Y_phosphatase	155	198	0.0054	17.1
TkA05G447760	`PF04179`	Init_tRNA_PT	161	198	0.2	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card