TkA05G439740 | RubberDandelionOmics

Gene overview

TkA05G439740

Reference: TK1151 Chr: Chr05 Coordinates: 109830473-109839210 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5550 bp · TkA05G439740|TK1151|cDNA

ATGGAGGTTAGTCCAATCCTTCTACTATTCTCCGCTACAGTATTTTTATTCTTTTCAAGCTCTGCTGCAGTAGACACCATATCAGCAAATCAACGAATCAAAGACGGCGAAACCATCGTCTCCGATGGTAATATGTATGAACTCGGGTTTTTCACCCCCGGAAACTCCAAGAATCGCTACGTGGGGATTTGGTACAAGCAAATATCAACCTGCACGGTTGTGTGGGTCGCTAACAGAGAGACGCCAATCAACGATACATC...

CDS

Download CDS FASTA

5550 bp · TkA05G439740|TK1151|CDS

ATGGAGGTTAGTCCAATCCTTCTACTATTCTCCGCTACAGTATTTTTATTCTTTTCAAGCTCTGCTGCAGTAGACACCATATCAGCAAATCAACGAATCAAAGACGGCGAAACCATCGTCTCCGATGGTAATATGTATGAACTCGGGTTTTTCACCCCCGGAAACTCCAAGAATCGCTACGTGGGGATTTGGTACAAGCAAATATCAACCTGCACGGTTGTGTGGGTCGCTAACAGAGAGACGCCAATCAACGATACATC...

Protein

Download Protein FASTA

1849 aa · TkA05G439740|TK1151|PROTEIN

MEVSPILLLFSATVFLFFSSSAAVDTISANQRIKDGETIVSDGNMYELGFFTPGNSKNRYVGIWYKQISTCTVVWVANRETPINDTSGEFTVTKEGNLLIHSHVWDESSTKESPIWESFDYPGNTLLTGMKLGMDLITGRERYLTSWKTPDDPSIGLYKAWVDTRGYPQVFESQGQVDYSRLGPWNGIGYRGFHVENTNPIYFVEFVVNEKEVYYRYKLNTSSLQRMVVMPDGIHCMKGFEPKVPKEWEAGDWSSGCQRK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G439740`
TK1151 ID	TkA05G439740
OH-1004 ID	LXL04_016743
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	43.400
Protein coverage (%)	TK1151 62.412 / OH-1004 88.912 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G439740

Location Chr05:109830473-109839210 (+)

Description Similar to RE1: Retrovirus-related Pol polyprotein from transposon RE1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release
`At4g27290`	G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290.	No verified direct reference in this release
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`At4g21380`	Involved in the regulation of cellular expansion and differentiation.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016743 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0006508 proteolysis Biological Process

GO:0015074 DNA integration Biological Process

GO:0003676 nucleic acid binding Molecular Function

GO:0003964 RNA-directed DNA polymerase activity Molecular Function

GO:0004190 aspartic-type endopeptidase activity Molecular Function

GO:0004519 endonuclease activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.519

Rank 1 · TkA05G439740 · TK1151

Nucleus0.280

Rank 2 · TkA05G439740 · TK1151

Endoplasmic reticulum0.136

Rank 3 · TkA05G439740 · TK1151

Cell membrane0.098

Rank 4 · TkA05G439740 · TK1151

Mitochondrion0.052

Rank 5 · TkA05G439740 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01453B_lectin72-107 aa

PF01453B_lectin107-148 aa

PF00954S_locus_glycop181-240 aa

PF05545FixQ342-367 aa

PF14244Retrotran_gag_3539-587 aa

PF14223Retrotran_gag_2569-743 aa

PF30379SLU7_N784-799 aa

PF22936Pol_BBD894-969 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G439740	`PF01453`	B_lectin	72	107	2e-20	73.9
TkA05G439740	`PF01453`	B_lectin	107	148	2e-20	73.9
TkA05G439740	`PF00954`	S_locus_glycop	181	240	0.00054	21.2
TkA05G439740	`PF05545`	FixQ	342	367	0.32	11.7
TkA05G439740	`PF14244`	Retrotran_gag_3	539	587	3.9e-15	56.1
TkA05G439740	`PF14223`	Retrotran_gag_2	569	743	7.9e-06	26.5
TkA05G439740	`PF30379`	SLU7_N	784	799	0.63	10.3
TkA05G439740	`PF22936`	Pol_BBD	894	969	4.3e-09	37.3
TkA05G439740	`PF13976`	gag_pre-integrs	1001	1066	4.2e-07	30.4
TkA05G439740	`PF00665`	rve	1084	1180	4.6e-12	46.8
TkA05G439740	`PF29688`	TnsB_C	1141	1193	0.0013	19.2
TkA05G439740	`PF11883`	DUF3403	1286	1300	0.0035	18.1
TkA05G439740	`PF07727`	RVT_2	1417	1525	2.9e-37	129.3
TkA05G439740	`PF08847`	Crr6	1439	1470	0.16	12.4
TkA05G439740	`PF07727`	RVT_2	1530	1570	2.9e-37	129.3
TkA05G439740	`PF30379`	SLU7_N	1591	1600	0.63	10.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	34.900%	Swiss-Prot	Low
`O81832`	Arabidopsis thaliana	sp\|O81832\|Y4729_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At4g27290	42.500%	Swiss-Prot	Low
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	33.700%	Swiss-Prot	Low
`O81905`	Arabidopsis thaliana	sp\|O81905\|SD18_ARATH Receptor-like serine/threonine-protein kinase SD1-8	32.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card