TkA05G438400 | RubberDandelionOmics

Gene overview

TkA05G438400

Reference: TK1151 Chr: Chr05 Coordinates: 109445502-109448101 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1252 bp · TkA05G438400|TK1151|cDNA

AAGCATTTCGTATAATCTTTTGCTAACACACTTGGAAATAATAAAAACCGCGAATTCTTTACACAGTCGCGTGGAGTGTTCGATACACACACAAAAAATCATACCACCGCCCATCGCCACCACATTCGCAGCAGATTTCAATTCACATGAGAAGAATTTTTAGCCAAATAATCTCATCGAAGGCGGTCAATCGGCCATTGCTGAATCAGAAATATGATTTTTCGGCTTTAACTTCAGAATTGTGAAAATTTCTAATGTCG...

CDS

Download CDS FASTA

705 bp · TkA05G438400|TK1151|CDS

ATGTCGAAAGACATCAACAACATCAGTGACGGTGATAACAAAAGTAGACCTAATCGGGATTCTTCAAGAGCGACGCAACAATATGGATCCTATCATCGCAATAAAAAGGAAGACGATATGAGGCTTTGGGGAATCCTTATTTTTGGAATCATCGGAGCTACTGCCACTTATTACGCCGTTGGACAATTACGGAGAACGGCTGATTGGTTTTACACACAGCTTTTCAGGAGGAAGCTCGAAGAAGGTACGCCCGTCGCATG...

Protein

Download Protein FASTA

234 aa · TkA05G438400|TK1151|PROTEIN

MSKDINNISDGDNKSRPNRDSSRATQQYGSYHRNKKEDDMRLWGILIFGIIGATATYYAVGQLRRTADWFYTQLFRRKLEEGTPVACRKNTKKRWKEWSELGVCKVCSIGRKISTEGGTRGGGKKKKMVHIINVFKETIGIGKTDTSYGRNWSNFKKPETPTVDYSLSHHYDILGLNRSRTTPYTDNEIKTAFRSKAMQYHPDQNQENKEIAEARFKEVMTSYEAIKSERKNIK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G438400`
TK1151 ID	TkA05G438400
OH-1004 ID	LXL04_021997
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	69.800
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G438400`
Location	Chr05:109445502-109448101 (+)
Description	Similar to dnaJ: Chaperone protein DnaJ (Chlorobium phaeobacteroides (strain DSM 266)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021997` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006260 DNA replication Biological Process GO:0006457 protein folding Biological Process GO:0006986 response to unfolded protein Biological Process GO:0008285 negative regulation of cell population proliferation Biological Process GO:0009408 response to heat Biological Process GO:0030308 negative regulation of cell growth Biological Process GO:0031396 regulation of protein ubiquitination Biological Process GO:0031398 positive regulation of protein ubiquitination Biological Process GO:0032091 negative regulation of protein binding Biological Process GO:0032436 positive regulation of proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0032781 positive regulation of ATP-dependent activity Biological Process GO:0032880 regulation of protein localization Biological Process
KEGG gene cross-reference	cph:Cpha266_1872 hsa:3300 mmu:56812 pla:Plav_3573 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.317

Rank 1 · TkA05G438400 · TK1151

Cytoplasm0.247

Rank 2 · TkA05G438400 · TK1151

Endoplasmic reticulum0.217

Rank 3 · TkA05G438400 · TK1151

Cell membrane0.179

Rank 4 · TkA05G438400 · TK1151

Nucleus0.171

Rank 5 · TkA05G438400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00226DnaJ170-231 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G438400	`PF00226`	DnaJ	170	231	2.4e-14	53.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card