TkA05G437700 | RubberDandelionOmics

Gene overview

TkA05G437700

Reference: TK1151 Chr: Chr05 Coordinates: 109285030-109288812 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2100 bp · TkA05G437700|TK1151|cDNA

AACTTAATCTACACCAATTAAATCGGAGTTGTTGTAACTAACAAATTAGCCAACTTTTTTATGAGCATCACGTTGTCTATAAATTAATTTGTGTTTCTTCAAATGGGGATTTACATTTCAACTACAAAGTCAGAAAGGATTTTGGTGCCGACAACTAGGAAGTTAGAAGGCTACTTTCAGTATCAATAAGTAGGAAACCGTGACTCGGTTTATACCAATATACACTGGATAATATGAGCTCGCGTTCAATAAATCTTCCC...

CDS

Download CDS FASTA

1170 bp · TkA05G437700|TK1151|CDS

ATGAGCTCGCGTTCAATAAATCTTCCCCTCCATGATCTAGGCGCAGGTATAAAAGAATATAAAAAGATCTATCGCCCACTCATGGCGGCATCATACAGCGGTGACTGGAAAGCTGCTAAGGTCATCATTGATGAACGACCGGAGTTGCTAAAGTATTCTATCACTCCCAATAAGGAGACATTACTTCATCTTGCTGCTTCAGCGGAAAAGTCCAAACTGACAGAAGAGTTCTTCGAAAACTTAGTAAATATGATGGAGAA...

Protein

Download Protein FASTA

389 aa · TkA05G437700|TK1151|PROTEIN

MSSRSINLPLHDLGAGIKEYKKIYRPLMAASYSGDWKAAKVIIDERPELLKYSITPNKETLLHLAASAEKSKLTEEFFENLVNMMEKEDLALENSESWNALMVAVANGSMKMVEIMIHKNEDLLRKCNKDDYFPLTLSAFYGHHDLARYLYNIWNGHISTYMNSREINFLVQQCVQAEMYDITFKILTDVSDQITSSGYTIVLDQLARRPISLNRPKQNIIRKNIDPILVKLHMKKGPSEDDNIALKLLKLVLDSFIKSS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G437700`
TK1151 ID	TkA05G437700
OH-1004 ID	LXL04_021989
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.700
Protein coverage (%)	TK1151 91.260 / OH-1004 59.966 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G437700`
Location	Chr05:109285030-109288812 (+)
Description	Similar to NPR4: Ankyrin repeat-containing protein NPR4
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_021989` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0009651 response to salt stress Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component
KEGG gene cross-reference	ath:AT3G12360 dosa:Os01g0837000 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.673

Rank 1 · TkA05G437700 · TK1151

Cytoplasm0.155

Rank 2 · TkA05G437700 · TK1151

Nucleus0.103

Rank 3 · TkA05G437700 · TK1151

Endoplasmic reticulum0.093

Rank 4 · TkA05G437700 · TK1151

Lysosome / Vacuole0.037

Rank 5 · TkA05G437700 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13606Ank_324-45 aa

PF13857Ank_524-53 aa

PF12796Ank_226-70 aa

PF00023Ank26-43 aa

PF12796Ank_227-123 aa

PF25397DUF788730-52 aa

PF13637Ank_436-69 aa

PF13857Ank_556-83 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G437700	`PF13606`	Ank_3	24	45	2.2e-11	43.5
TkA05G437700	`PF13857`	Ank_5	24	53	1.1e-06	29.6
TkA05G437700	`PF12796`	Ank_2	26	70	2.1e-22	80.2
TkA05G437700	`PF00023`	Ank	26	43	6.4e-10	39.4
TkA05G437700	`PF12796`	Ank_2	27	123	2.1e-22	80.2
TkA05G437700	`PF25397`	DUF7887	30	52	0.12	12.8
TkA05G437700	`PF13637`	Ank_4	36	69	2e-07	31.8
TkA05G437700	`PF13857`	Ank_5	56	83	1.1e-06	29.6
TkA05G437700	`PF13606`	Ank_3	58	79	2.2e-11	43.5
TkA05G437700	`PF00023`	Ank	58	70	6.4e-10	39.4
TkA05G437700	`PF12796`	Ank_2	62	151	2.1e-22	80.2
TkA05G437700	`PF13857`	Ank_5	92	125	1.1e-06	29.6
TkA05G437700	`PF13637`	Ank_4	94	116	2e-07	31.8
TkA05G437700	`PF13606`	Ank_3	98	123	2.2e-11	43.5
TkA05G437700	`PF00023`	Ank	98	123	6.4e-10	39.4
TkA05G437700	`PF13637`	Ank_4	102	150	2e-07	31.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card