TkA05G429240 | RubberDandelionOmics

Gene overview

TkA05G429240

Reference: TK1151 Chr: Chr05 Coordinates: 107069635-107070758 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

333 bp · TkA05G429240|TK1151|cDNA

CAGCAAGGGGGAGTTCAAGGGCGTTCAAGAACACCAATTTATGAAGCTTTAATTCTTGTTGAGCGAGAGGCACAGTTTGACAGGACTAGATCCCATCTTGGAAACCATGTGCGATTCTTTGAAGCTCCAGTGCAGGTCAAACCAAAGTATGAAGAGAAGGATAAGGGGCGTCCACGAATGAATGAACAAATATCTTCTCAGATGTTTGCAAGGAGACTCAATGTTGATTTAGTTGAGGTTCAACAAGATGCTAAACCACG...

CDS

Download CDS FASTA

333 bp · TkA05G429240|TK1151|CDS

CAGCAAGGGGGAGTTCAAGGGCGTTCAAGAACACCAATTTATGAAGCTTTAATTCTTGTTGAGCGAGAGGCACAGTTTGACAGGACTAGATCCCATCTTGGAAACCATGTGCGATTCTTTGAAGCTCCAGTGCAGGTCAAACCAAAGTATGAAGAGAAGGATAAGGGGCGTCCACGAATGAATGAACAAATATCTTCTCAGATGTTTGCAAGGAGACTCAATGTTGATTTAGTTGAGGTTCAACAAGATGCTAAACCACG...

Protein

Download Protein FASTA

110 aa · TkA05G429240|TK1151|PROTEIN

QQGGVQGRSRTPIYEALILVEREAQFDRTRSHLGNHVRFFEAPVQVKPKYEEKDKGRPRMNEQISSQMFARRLNVDLVEVQQDAKPRVCKLMDYNKEMYLRKVKEKEQTK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G429240`
TK1151 ID	TkA05G429240
OH-1004 ID	LXL04_034224
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	97.600
Protein coverage (%)	TK1151 74.545 / OH-1004 85.417 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G429240

Location Chr05:107069635-107070758 (-)

Description Similar to IF3-1: Translation initiation factor IF3-1, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g34360`	IF-3 binds to the 30S ribosomal subunit and shifts the equilibrium between 70S ribosomes and their 50S and 30S subunits in favor of the free subunits, thus enhancing the availability of 30S subunits on which protein synthesis initiation begins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_034224 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0032790 ribosome disassembly Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0016020 membrane Cellular Component

GO:0003743 translation initiation factor activity Molecular Function

GO:0043022 ribosome binding Molecular Function

KEGG gene cross-reference

ath:AT1G34360

ban:BA_4819

bar:GBAA_4819

bat:BAS4471

bca:BCE_4706

bcl:ABC2689

bcz:BCE33L4317

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.697

Rank 1 · TkA05G429240 · TK1151

Cytoplasm0.287

Rank 2 · TkA05G429240 · TK1151

Mitochondrion0.057

Rank 3 · TkA05G429240 · TK1151

Cell membrane0.026

Rank 4 · TkA05G429240 · TK1151

Endoplasmic reticulum0.019

Rank 5 · TkA05G429240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05198IF3_N47-56 aa

PF05198IF3_N69-108 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G429240	`PF05198`	IF3_N	47	56	3.8e-11	43.7
TkA05G429240	`PF05198`	IF3_N	69	108	3.8e-11	43.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NLP2`	Arabidopsis thaliana	sp\|Q6NLP2\|IF31_ARATH Translation initiation factor IF3-1, mitochondrial	34.100%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card