TkA05G428170 | RubberDandelionOmics

Gene overview

TkA05G428170

Reference: TK1151 Chr: Chr05 Coordinates: 106761520-106767710 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1773 bp · TkA05G428170|TK1151|cDNA

ATGCAATTACGAAGTCTTCTTCTCCACCTTCTCAATTTATCGATTGTATACAGACTCGGTGTAGTTCACTCGGCATCTGCGATCTGTGAATTCAGTGTCACCCAACAGAACAAGCTCTATAGTTACAGCTTGGCTTCCTCTTCGAAAACGTTCCCTCATGGCGTTCTCAGCGAAGACGGATACTACAAGGTGTCATCTAATGGAACAGTGATTTGGTTTCAGCTTTGTGATGGAATGATTTTCAACCATGATCCACCAAG...

CDS

Download CDS FASTA

1773 bp · TkA05G428170|TK1151|CDS

ATGCAATTACGAAGTCTTCTTCTCCACCTTCTCAATTTATCGATTGTATACAGACTCGGTGTAGTTCACTCGGCATCTGCGATCTGTGAATTCAGTGTCACCCAACAGAACAAGCTCTATAGTTACAGCTTGGCTTCCTCTTCGAAAACGTTCCCTCATGGCGTTCTCAGCGAAGACGGATACTACAAGGTGTCATCTAATGGAACAGTGATTTGGTTTCAGCTTTGTGATGGAATGATTTTCAACCATGATCCACCAAG...

Protein

Download Protein FASTA

590 aa · TkA05G428170|TK1151|PROTEIN

MQLRSLLLHLLNLSIVYRLGVVHSASAICEFSVTQQNKLYSYSLASSSKTFPHGVLSEDGYYKVSSNGTVIWFQLCDGMIFNHDPPRCFDCLGCGGSSQCGMGCSALVSENRAGYPVCSTIGRIQTTTTDLIDKENPDKGITVKMWHKGLEMNCSLSVSVICDSKQVQGPKTLEKLGQCHFTTQITHPAGCANVLSTPGNGLGWFTTLLIIILCLFGGYLIAGAAYRYFYLGIRGIEIIPNLELWASLPHRIRLFCSFVA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G428170`
TK1151 ID	TkA05G428170
OH-1004 ID	LXL04_005843
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	78.600
Protein coverage (%)	TK1151 44.746 / OH-1004 8.452 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G428170`
Location	Chr05:106761520-106767710 (-)
Description	Similar to SBT: Subtilisin-like protease
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_005843` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006508 proteolysis Biological Process GO:0009609 response to symbiotic bacterium Biological Process GO:0009610 response to symbiotic fungus Biological Process GO:0036377 arbuscular mycorrhizal association Biological Process GO:0005615 extracellular space Cellular Component GO:0048046 apoplast Cellular Component GO:0004252 serine-type endopeptidase activity Molecular Function
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.367

Rank 1 · TkA05G428170 · TK1151

Cell membrane0.275

Rank 2 · TkA05G428170 · TK1151

Lysosome / Vacuole0.182

Rank 3 · TkA05G428170 · TK1151

Cytoplasm0.125

Rank 4 · TkA05G428170 · TK1151

Golgi apparatus0.094

Rank 5 · TkA05G428170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF09451ATG2726-263 aa

PF02157Man-6-P_recep175-269 aa

PF14244Retrotran_gag_3284-331 aa

PF13961DUF4219298-312 aa

PF14223Retrotran_gag_2310-482 aa

PF17241Retrotran_gag_4344-393 aa

PF30901PEG10-RTL1_C-capsid392-419 aa

PF30901PEG10-RTL1_C-capsid441-479 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G428170	`PF09451`	ATG27	26	263	9.3e-16	59.2
TkA05G428170	`PF02157`	Man-6-P_recep	175	269	9.5e-06	25.7
TkA05G428170	`PF14244`	Retrotran_gag_3	284	331	3.7e-18	65.8
TkA05G428170	`PF13961`	DUF4219	298	312	0.024	15.1
TkA05G428170	`PF14223`	Retrotran_gag_2	310	482	5.6e-14	53.0
TkA05G428170	`PF17241`	Retrotran_gag_4	344	393	0.019	15.4
TkA05G428170	`PF30901`	PEG10-RTL1_C-capsid	392	419	0.022	15.4
TkA05G428170	`PF30901`	PEG10-RTL1_C-capsid	441	479	0.022	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card