TkA05G426340 | RubberDandelionOmics

Gene overview

TkA05G426340

Reference: TK1151 Chr: Chr05 Coordinates: 106326843-106327469 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

627 bp · TkA05G426340|TK1151|cDNA

ATGCGTACCTCCGTTCAAATCCAAAGAATTCAAGAAAGCAACAACCTCAAAACAACCGTGAACCACCGCAACCACCTCCCTATCATTACTACAATATCGAGAGTGCCGCCGTCGGTTTGCCTCCCGGAAGAGCTCCACCACCACCACACTCACGCGGTGGGTCAAAACCAGTGTTCCTCCACAATAACCCAGTCGATCTCAGCCCCCGTGGAAACCGTCTGGTCGGTCGTCCGTCGATTCGACACCCCGCAGGCGTACAA...

CDS

Download CDS FASTA

627 bp · TkA05G426340|TK1151|CDS

ATGCGTACCTCCGTTCAAATCCAAAGAATTCAAGAAAGCAACAACCTCAAAACAACCGTGAACCACCGCAACCACCTCCCTATCATTACTACAATATCGAGAGTGCCGCCGTCGGTTTGCCTCCCGGAAGAGCTCCACCACCACCACACTCACGCGGTGGGTCAAAACCAGTGTTCCTCCACAATAACCCAGTCGATCTCAGCCCCCGTGGAAACCGTCTGGTCGGTCGTCCGTCGATTCGACACCCCGCAGGCGTACAA...

Protein

Download Protein FASTA

208 aa · TkA05G426340|TK1151|PROTEIN

MRTSVQIQRIQESNNLKTTVNHRNHLPIITTISRVPPSVCLPEELHHHHTHAVGQNQCSSTITQSISAPVETVWSVVRRFDTPQAYKQFLKSCHVIVGDGDVGSVREVQVVSGLPAGSSMERLEILDEESHVISFSVVGGDHRLKNYRSVTTLHCLPSTGGGNTVVVESYVVDVPPENTKEETCVFVDTIVRCNLQSLKQMAENLANK

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G426340`
TK1151 ID	TkA05G426340
OH-1004 ID	LXL04_021830
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G426340

Location Chr05:106326843-106327469 (+)

Description Similar to PYL6: Abscisic acid receptor PYL6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38310`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At2g40330`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At5g05440`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	No verified direct reference in this release
`At1g01360`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	Regulators of PP2C phosphatase activity function as abscisic acid sensors.2009 · DOI: 10.1126/science.1172408
`At5g53160`	Receptor for abscisic acid (ABA) required for ABA-mediated responses such as stomatal closure and germination inhibition.	Closely related receptor complexes differ in their ABA selectivity and sensitivity.2010 · DOI: 10.1111/j.1365-313x.2009.04025.x The nuclear interactor PYL8/RCAR3 of Fagus sylvatica FsPP2C1 is a positive regulator of abscisic acid signaling in seeds and stress.2010 · DOI: 10.1104/pp.109.146381

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021830 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009789 positive regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0004864 protein phosphatase inhibitor activity Molecular Function

GO:0010427 abscisic acid binding Molecular Function

KEGG gene cross-reference

ath:AT1G01360

ath:AT2G38310

ath:AT2G40330

ath:AT5G05440

ath:AT5G53160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.582

Rank 1 · TkA05G426340 · TK1151

Nucleus0.508

Rank 2 · TkA05G426340 · TK1151

Cell membrane0.084

Rank 3 · TkA05G426340 · TK1151

Plastid0.062

Rank 4 · TkA05G426340 · TK1151

Endoplasmic reticulum0.061

Rank 5 · TkA05G426340 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10604Polyketide_cyc258-203 aa

PF03364Polyketide_cyc66-141 aa

PF00407Bet_v_181-165 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G426340	`PF10604`	Polyketide_cyc2	58	203	1.2e-16	61.9
TkA05G426340	`PF03364`	Polyketide_cyc	66	141	0.0043	18.0
TkA05G426340	`PF00407`	Bet_v_1	81	165	1.3e-06	29.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80920`	Arabidopsis thaliana	sp\|O80920\|PYL4_ARATH Abscisic acid receptor PYL4	69.400%	Swiss-Prot	High
`Q8S8E3`	Arabidopsis thaliana	sp\|Q8S8E3\|PYL6_ARATH Abscisic acid receptor PYL6	57.100%	Swiss-Prot	High
`Q9FLB1`	Arabidopsis thaliana	sp\|Q9FLB1\|PYL5_ARATH Abscisic acid receptor PYL5	68.600%	Swiss-Prot	High
`Q84MC7`	Arabidopsis thaliana	sp\|Q84MC7\|PYL9_ARATH Abscisic acid receptor PYL9	54.000%	Swiss-Prot	High
`Q9FGM1`	Arabidopsis thaliana	sp\|Q9FGM1\|PYL8_ARATH Abscisic acid receptor PYL8	54.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card