TkA05G418460 | RubberDandelionOmics

Gene overview

TkA05G418460

Reference: TK1151 Chr: Chr05 Coordinates: 104205374-104208183 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2120 bp · TkA05G418460|TK1151|cDNA

TGGTGACTTTAAACAAATTTAAGAAATGTTAGGTTATGGCTTTTGGATAACTTGAAACCGAATCCTTCCTTAACCTTATTCTCAAATGACATCCCACAACAATCACAAGTCAAGAATCTCCCCTCTCTCTCCTCTTTCTTCAGAAGACTCCTTTCTGAAAGTCCATCTTCCAAACAGAACTTTCCATTTCTATCATGACACCCAAAAACCCACATTCCTTATCTATTGCCAAATTGGGTAATAAATTCTTAAATCTCTGA...

CDS

Download CDS FASTA

1080 bp · TkA05G418460|TK1151|CDS

ATGGAGAACGGCCACAAGCTTATTCTTATCGTAACTTCATCCGTTTCGTTTATTGCGTTCGTTTTTCTGGGCTTAATTTGTGTCTGTAGAAGAAAAGTATCCAAAAACGATGAAGAATCAAGCTTTGATAGTAAAGAAATGGAGATAAACGGGGAGTTAACTAGGTTTAACGGCGGTGAAGACTTGACATGTGGTGATATATTGGATGCCCCTGGTGAAGTAATTGGGAAATCAAGATACGGGACTTTGTACAAAGCTAA...

Protein

Download Protein FASTA

359 aa · TkA05G418460|TK1151|PROTEIN

MENGHKLILIVTSSVSFIAFVFLGLICVCRRKVSKNDEESSFDSKEMEINGELTRFNGGEDLTCGDILDAPGEVIGKSRYGTLYKANLVSNDSVVCLRFLRPTCTENVQDLVPMVQLMGSIQHPNLVPLLGFYSGPRGEKLLVHPFYEMGNLAQFIIDGKDECHKWKVICRISTGIARGLHHLHTGFQKPIIHGNLKSKNILMGQNHHPFVSDFGLHTFLKPDAAQEMLQEADMEGYKAPELMKMEDSNKATDIYSFGLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G418460`
TK1151 ID	TkA05G418460
OH-1004 ID	LXL04_021747
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G418460

Location Chr05:104205374-104208183 (-)

Description Similar to TMKL1: Putative kinase-like protein TMKL1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g24660`	Does not seem to have conserved a kinase activity.	No verified direct reference in this release
`At3g56100`	Can phosphorylate AGL24.	No verified direct reference in this release
`At3g51740`	Probably inactive leucine-rich repeat receptor-like protein kinase IMK2.	No verified direct reference in this release
`At3g08680`	Probable inactive receptor kinase At3g08680.	No verified direct reference in this release
`At4g31250`	Probable LRR receptor-like serine/threonine-protein kinase At4g31250.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021747 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042742 defense response to bacterium Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0009506 plasmodesma Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G48480

ath:AT3G08680

ath:AT3G24660

ath:AT3G51740

ath:AT3G56100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.804

Rank 1 · TkA05G418460 · TK1151

Cytoplasm0.119

Rank 2 · TkA05G418460 · TK1151

Nucleus0.092

Rank 3 · TkA05G418460 · TK1151

Endoplasmic reticulum0.074

Rank 4 · TkA05G418460 · TK1151

Golgi apparatus0.023

Rank 5 · TkA05G418460 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29119F13C5_C13-33 aa

PF07714PK_Tyr_Ser-Thr73-286 aa

PF00069Pkinase73-281 aa

PF07714PK_Tyr_Ser-Thr324-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G418460	`PF29119`	F13C5_C	13	33	0.12	12.9
TkA05G418460	`PF07714`	PK_Tyr_Ser-Thr	73	286	2.2e-31	109.8
TkA05G418460	`PF00069`	Pkinase	73	281	2.5e-26	93.4
TkA05G418460	`PF07714`	PK_Tyr_Ser-Thr	324	348	2.2e-31	109.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P33543`	Arabidopsis thaliana	sp\|P33543\|TMKL1_ARATH Putative kinase-like protein TMKL1	36.400%	Swiss-Prot	Medium
`C0LGP9`	Arabidopsis thaliana	sp\|C0LGP9\|IMK3_ARATH Probable leucine-rich repeat receptor-like protein kinase IMK3	34.900%	Swiss-Prot	Medium
`Q9SCT4`	Arabidopsis thaliana	sp\|Q9SCT4\|IMK2_ARATH Probably inactive leucine-rich repeat receptor-like protein kinase IMK2	34.000%	Swiss-Prot	Medium
`Q9C9Y8`	Arabidopsis thaliana	sp\|Q9C9Y8\|Y3868_ARATH Probable inactive receptor kinase At3g08680	29.700%	Swiss-Prot	Low
`C0LGR9`	Arabidopsis thaliana	sp\|C0LGR9\|Y4312_ARATH Probable LRR receptor-like serine/threonine-protein kinase At4g31250	29.300%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card