TkA05G416830 | RubberDandelionOmics

Gene overview

TkA05G416830

Reference: TK1151 Chr: Chr05 Coordinates: 103761960-103763844 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1114 bp · TkA05G416830|TK1151|cDNA

TTTTGGTATACAGGATAGATTGTAGACGTTCGAAAGAAGAAAAAGAAACCAGCAAGCTAGGGTTTTAGACAGTGAAAATCATGGTGGCAGGGTTAAGGGTTTTTACCGAGAGATCGGACGACGGCGCAGCTGGTACACCTGTTCTCGATACCGCCAACGGCGAGGAGCTTATGCATGTCCAGCCGGCCGTCGCAATTGCTCTCGGCAACCGTCCTCCCGAGTCTCCCGGCACGCTCTACATCTCTACCAAAAAAGTGGTA...

CDS

Download CDS FASTA

711 bp · TkA05G416830|TK1151|CDS

ATGGTGGCAGGGTTAAGGGTTTTTACCGAGAGATCGGACGACGGCGCAGCTGGTACACCTGTTCTCGATACCGCCAACGGCGAGGAGCTTATGCATGTCCAGCCGGCCGTCGCAATTGCTCTCGGCAACCGTCCTCCCGAGTCTCCCGGCACGCTCTACATCTCTACCAAAAAAGTGGTATGGTTGAGCGATACCGAGAGGACAAAAGGCTACGCTGTTGATTTCTTGTCTGTGTCTCTTCACGCGGTGTCTAGAGATCC...

Protein

Download Protein FASTA

236 aa · TkA05G416830|TK1151|PROTEIN

MVAGLRVFTERSDDGAAGTPVLDTANGEELMHVQPAVAIALGNRPPESPGTLYISTKKVVWLSDTERTKGYAVDFLSVSLHAVSRDPEAFSSPCIYTQIDTGDEDDESESSDSDSNEPLDLSKITEMRLVPSDHTQLDALFDIFCECAELNPELVEENENEPEHNWIFSADQLGPNMGLDGVDQEWDSPQADFIIGQLNGTHDLAPHMLELQINDQRFEDAEEMETNNRNGDQHGM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G416830`
TK1151 ID	TkA05G416830
OH-1004 ID	LXL04_021713
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G416830

Location Chr05:103761960-103763844 (+)

Description Similar to At5g62290: Chloride conductance regulatory protein ICln

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g62290`	May participate in cellular volume control by activation of a swelling-induced chloride conductance pathway.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021713 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000387 spliceosomal snRNP assembly Biological Process

GO:0000398 mRNA splicing, via spliceosome Biological Process

GO:0006821 chloride transport Biological Process

GO:0006884 cell volume homeostasis Biological Process

GO:0045292 mRNA cis splicing, via spliceosome Biological Process

GO:0048026 positive regulation of mRNA splicing, via spliceosome Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005681 spliceosomal complex Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005856 cytoskeleton Cellular Component

KEGG gene cross-reference

ath:AT5G62290

cfa:403971

rno:65160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.679

Rank 1 · TkA05G416830 · TK1151

Cytoplasm0.599

Rank 2 · TkA05G416830 · TK1151

Cell membrane0.046

Rank 3 · TkA05G416830 · TK1151

Mitochondrion0.035

Rank 4 · TkA05G416830 · TK1151

Endoplasmic reticulum0.035

Rank 5 · TkA05G416830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03517Voldacs50-161 aa

PF03517Voldacs215-225 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G416830	`PF03517`	Voldacs	50	161	2.8e-27	96.3
TkA05G416830	`PF03517`	Voldacs	215	225	2.8e-27	96.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVA7`	Arabidopsis thaliana	sp\|Q9LVA7\|ICLN_ARATH Chloride conductance regulatory protein ICln	69.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card