TkA05G412750 | RubberDandelionOmics

Gene overview

TkA05G412750

Reference: TK1151 Chr: Chr05 Coordinates: 102699758-102701549 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1261 bp · TkA05G412750|TK1151|cDNA

TTTCGAACAAAAGTCAAAGGGGTAGCACACAAGTTGTGTTTCCTATATATAATCACTTACTTTGAGTATATCAATCCCACAAGCATATATAGTCAAACTCCCCCTTTATATACAAAAGTTCTAAAAAAGTCAACGTTTTTTTTCCGGCGCCGGTAACTGACACGCCGTATACATTTGACCGGAGGAGAAACGCGGTTTAACTTTTTTCCTTTAATGGATGAAGAATGGGATTTGCATGCGGTGGTTAGGAGCTGCACCAC...

CDS

Download CDS FASTA

666 bp · TkA05G412750|TK1151|CDS

ATGGATGAAGAATGGGATTTGCATGCGGTGGTTAGGAGCTGCACCACCACCTCCGCCGACACCATGGCCAACACAACCACCAGCGACGATGGTTTTGATATGGTGGAGACGGTGGTAGAATCCGGCAATGAAATATTCCCGTTTTCTTATTCAAATTCCGGCGAGAACCCATATGAGGGATTAGAGGAAGTGTACAAAGAAGGGTGTTCTCATCAGCGGCAGAGCACCACCACCACCGCCACCACTGCCGCCGACGTCGT...

Protein

Download Protein FASTA

221 aa · TkA05G412750|TK1151|PROTEIN

MDEEWDLHAVVRSCTTTSADTMANTTTSDDGFDMVETVVESGNEIFPFSYSNSGENPYEGLEEVYKEGCSHQRQSTTTTATTAADVVFGDDEQLVVLDGCDLFSNETPSRKRKNQQKKMVVELTQEELCSDTWAWRKYGQKPIKGSPFPRNYYKCSTTKACGARKQVEQSHTDPTVFIVSYSGEHIHPRPTHRSPLAGSTRSNKSTTVAHAPPISDSNVHS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G412750`
TK1151 ID	TkA05G412750
OH-1004 ID	LXL04_026695
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	67.300
Protein coverage (%)	TK1151 45.701 / OH-1004 28.696 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G412750

Location Chr05:102699758-102701549 (-)

Description Similar to WRKY22: WRKY transcription factor 22

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g52830`	Transcription factor.	No verified direct reference in this release
`At4g01250`	Transcription factor involved in the expression of defense genes in innate immune response of plants.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a
`At4g23550`	Transcription factor involved in the expression of defense genes in innate immune response of plants.	MAP kinase signalling cascade in Arabidopsis innate immunity.2002 · DOI: 10.1038/415977a
`At2g34830`	Transcription factor.	No verified direct reference in this release
`At1g30650`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026695 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0007263 nitric oxide mediated signal transduction Biological Process

GO:0009408 response to heat Biological Process

GO:0009555 pollen development Biological Process

GO:0009739 response to gibberellin Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010150 leaf senescence Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0071456 cellular response to hypoxia Biological Process

GO:0140921 negative regulation of thermomorphogenesis Biological Process

KEGG gene cross-reference

ath:AT1G30650

ath:AT2G34830

ath:AT4G01250

ath:AT5G52830

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.969

Rank 1 · TkA05G412750 · TK1151

Cytoplasm0.093

Rank 2 · TkA05G412750 · TK1151

Cell membrane0.026

Rank 3 · TkA05G412750 · TK1151

Endoplasmic reticulum0.018

Rank 4 · TkA05G412750 · TK1151

Plastid0.010

Rank 5 · TkA05G412750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08002DUF169727-86 aa

PF03106WRKY68-74 aa

PF03106WRKY131-188 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G412750	`PF08002`	DUF1697	27	86	0.2	12.7
TkA05G412750	`PF03106`	WRKY	68	74	5.2e-25	88.1
TkA05G412750	`PF03106`	WRKY	131	188	5.2e-25	88.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLX8`	Arabidopsis thaliana	sp\|Q9FLX8\|WRK27_ARATH Probable WRKY transcription factor 27	67.300%	Swiss-Prot	Low
`O04609`	Arabidopsis thaliana	sp\|O04609\|WRK22_ARATH WRKY transcription factor 22	42.000%	Swiss-Prot	Medium
`Q9SUS1`	Arabidopsis thaliana	sp\|Q9SUS1\|WRK29_ARATH Probable WRKY transcription factor 29	56.900%	Swiss-Prot	Low
`O64747`	Arabidopsis thaliana	sp\|O64747\|WRK35_ARATH Probable WRKY transcription factor 35	55.900%	Swiss-Prot	Low
`Q9SA80`	Arabidopsis thaliana	sp\|Q9SA80\|WRK14_ARATH Probable WRKY transcription factor 14	55.200%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card