TkA05G409010 | RubberDandelionOmics

Gene overview

TkA05G409010

Reference: TK1151 Chr: Chr05 Coordinates: 101702458-101706161 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1321 bp · TkA05G409010|TK1151|cDNA

ATATATGGGATCCCTATATATATAGCTGGATCCAGAATCTTTTACATCTTCATTTCAAAATCAAAAGGGGATATACATACACACACACACACACACTCTTCCTAATTCATTGAATCTATATCTCCAACAACTCCGCCATTAAAGATCTCAACATCGTTCACGTCTCCTAGGAAGATTAAAAAGGCTATGACCTTATCAATCTTCCAAAATTCAACAACTTAAATCGATTTTGATGGGTTGCATTTGTTCATCTGGTGTTA...

CDS

Download CDS FASTA

642 bp · TkA05G409010|TK1151|CDS

ATGGGTTGCATTTGTTCATCTGGTGTTAAGCATACCCCTGGGTACGAAGAACCCACTCTTCTCGCCGACGAAACCCCATTTACCGTGAGTGAAGTTGAGGCGTTGTATGAGCTTTTTAAGAAATTAAGCAGCTCGATTATCGACGATGGACTAATTCACAAGGAGGAATTCCAACTTGCGCTTTTCAGGAACAGAAACAGGCGAAATCTCTTTGCGGATAGGATATTCGATCTATTTGATGTGAAACGTAATGGGGTTAT...

Protein

Download Protein FASTA

213 aa · TkA05G409010|TK1151|PROTEIN

MGCICSSGVKHTPGYEEPTLLADETPFTVSEVEALYELFKKLSSSIIDDGLIHKEEFQLALFRNRNRRNLFADRIFDLFDVKRNGVIEFGEFVRSLGVFHPNAPVQDKIAFAFRLYDLRHTGFIEREELKEMVIALLHESDLVLSEEYIETIVDKTFSDADINGDGKIDEDEWKQFVAKNPSLIKNMTLHYLKDITLAFPSFVLSSEVEDSEV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G409010`
TK1151 ID	TkA05G409010
OH-1004 ID	LXL04_029859
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	67.100
Protein coverage (%)	TK1151 98.592 / OH-1004 98.592 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G409010

Location Chr05:101702458-101706161 (+)

Description Similar to CBL9: Calcineurin B-like protein 9

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24270`	May act as a calcium sensor regulating intracellular Na⁺/K⁺ homeostasis and salt tolerance.	The Arabidopsis SOS2 protein kinase physically interacts with and is activated by the calcium-binding protein SOS3.2000 · DOI: 10.1073/pnas.97.7.3735 SOS3 function in plant salt tolerance requires N-myristoylation and calcium binding.2000 · DOI: 10.1105/tpc.12.9.1667 Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3.2002 · DOI: 10.1073/pnas.122224699 Calcium-dependent modulation and plasma membrane targeting of the AKT2 potassium channel by the CBL4/CIPK6 calcium sensor/protein kinase complex.2011 · DOI: 10.1038/cr.2011.50 Arabidopsis SOS3 plays an important role in salt tolerance by mediating calcium-dependent microfilament reorganization.2013 · DOI: 10.1007/s00299-012-1348-3

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0291000`	Acts as a calcium sensor.	No verified direct reference in this release
`Os02g0291400`	Acts as a calcium sensor.	Expression analysis of the calcineurin B-like gene family in rice (Oryza sativa L.) under environmental stresses.2008 · DOI: 10.1016/j.gene.2008.02.011
`Os05g0534400`	Acts as a calcium sensor involved in the regulatory pathway for the control of intracellular Na(+) and K(+) homeostasis and salt tolerance.	Conservation of the salt overly sensitive pathway in rice.2007 · DOI: 10.1104/pp.106.092635
`Os10g0564800`	Acts as a calcium sensor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029859 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0016036 cellular response to phosphate starvation Biological Process

GO:0019722 calcium-mediated signaling Biological Process

GO:0055075 potassium ion homeostasis Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005773 vacuole Cellular Component

KEGG gene cross-reference

ath:AT4G17615

ath:AT5G47100

ath:AT5G55990

dosa:Os02g0291000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.446

Rank 1 · TkA05G409010 · TK1151

Cell membrane0.381

Rank 2 · TkA05G409010 · TK1151

Nucleus0.171

Rank 3 · TkA05G409010 · TK1151

Lysosome / Vacuole0.127

Rank 4 · TkA05G409010 · TK1151

Golgi apparatus0.098

Rank 5 · TkA05G409010 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13499EF-hand_733-58 aa

PF12763EH33-93 aa

PF13405EF-hand_635-61 aa

PF21857DUF691347-87 aa

PF13499EF-hand_748-94 aa

PF00036EF-hand_149-61 aa

PF13202EF-hand_549-58 aa

PF30347RSA-1_C58-133 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G409010	`PF13499`	EF-hand_7	33	58	4.4e-16	59.7
TkA05G409010	`PF12763`	EH	33	93	0.0025	18.5
TkA05G409010	`PF13405`	EF-hand_6	35	61	1.2e-15	56.4
TkA05G409010	`PF21857`	DUF6913	47	87	0.038	14.6
TkA05G409010	`PF13499`	EF-hand_7	48	94	4.4e-16	59.7
TkA05G409010	`PF00036`	EF-hand_1	49	61	1.3e-19	69.0
TkA05G409010	`PF13202`	EF-hand_5	49	58	1.8e-13	50.0
TkA05G409010	`PF30347`	RSA-1_C	58	133	0.0029	18.5
TkA05G409010	`PF30624`	EF_SSP120	65	93	6.6e-06	27.4
TkA05G409010	`PF23564`	EF-hand_FSTL1	68	96	1.6e-06	29.2
TkA05G409010	`PF13833`	EF-hand_8	72	94	2.3e-06	28.0
TkA05G409010	`PF00036`	EF-hand_1	73	94	1.3e-19	69.0
TkA05G409010	`PF13202`	EF-hand_5	73	94	1.8e-13	50.0
TkA05G409010	`PF10591`	SPARC_Ca_bdg	73	92	0.0059	17.6
TkA05G409010	`PF13405`	EF-hand_6	74	96	1.2e-15	56.4
TkA05G409010	`PF20743`	DUF5580_C	76	89	0.062	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81223`	Arabidopsis thaliana	sp\|O81223\|CNBL4_ARATH Calcineurin B-like protein 4	77.000%	Swiss-Prot	High
`Q3HRP0`	Oryza sativa subsp. japonica	sp\|Q3HRP0\|CNBL7_ORYSJ Calcineurin B-like protein 7	71.400%	Swiss-Prot	High
`Q3HRN9`	Oryza sativa subsp. japonica	sp\|Q3HRN9\|CNBL8_ORYSJ Calcineurin B-like protein 8	70.900%	Swiss-Prot	High
`Q75KU4`	Oryza sativa subsp. japonica	sp\|Q75KU4\|CNBL4_ORYSJ Calcineurin B-like protein 4	69.000%	Swiss-Prot	High
`Q7XC27`	Oryza sativa subsp. japonica	sp\|Q7XC27\|CNBL1_ORYSJ Calcineurin B-like protein 1	66.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card