TkA05G394650 | RubberDandelionOmics

Gene overview

TkA05G394650

Reference: TK1151 Chr: Chr05 Coordinates: 98092587-98094876 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1694 bp · TkA05G394650|TK1151|cDNA

TTGCCTTTAAAAGTTTCATGACGAAAGTTTACCTGCAAAAAGGACTTGCGAGACATTTTGGTTCCTCTGGTCGGGGCCACCGGAATCGGTAAAGCGGTCCATATCTTGTACAGTATTATTATATGCTTTCATCCTCCGTCTCCTTCACTTCCCTCTCATACCAGAACCCTCGAGGATCACCAGTCTTAATCTTAGGTCAAAATGCATACGGAACTTGAAGACTACATAACCGACCTCCCTCAAAGCATAATCGAAATCAT...

CDS

Download CDS FASTA

1263 bp · TkA05G394650|TK1151|CDS

ATGCATACGGAACTTGAAGACTACATAACCGACCTCCCTCAAAGCATAATCGAAATCATACTCACAAAGCTGCCATTAAGAGACGCTGTAAAAACAAGCATATTATCTTCAAAATGGAGGTACAAATGGGCCACTCTCACACACCTCGAGTTTGATGACAAATGTGTTTCCGGGACCCACGATAGATCAATTGCAGAAACAAATCTTGTAAAATTCATCACTCGGTTTCTTTTCCTCCATGATGGGCCCATCAATCGCTT...

Protein

Download Protein FASTA

420 aa · TkA05G394650|TK1151|PROTEIN

MHTELEDYITDLPQSIIEIILTKLPLRDAVKTSILSSKWRYKWATLTHLEFDDKCVSGTHDRSIAETNLVKFITRFLFLHDGPINRFSLSTAYLQSSPDVDQWLLFLSRKNVKELVLELGEGEWFKAPSCLFSCKKLIRLELVRCELDPPLSFKGFPYLKHLNLQQVLIAPDAVENLISGCQLLESLTLSYFDSLELTIRAPNLKFLILEGEFKDICLENTPKLVAISVAMYMTDDIAEHFGQSQSCNFDKFLGGAPSLQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G394650`
TK1151 ID	TkA05G394650
OH-1004 ID	LXL04_021437
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.800
Protein coverage (%)	TK1151 100.000 / OH-1004 51.095 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G394650

Location Chr05:98092587-98094876 (-)

Description Similar to At1g13570: F-box/FBD/LRR-repeat protein At1g13570

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13570`	F-box/FBD/LRR-repeat protein At1g13570.	No verified direct reference in this release
`At1g66310`	FBD-associated F-box protein At1g66310.	No verified direct reference in this release
`At5g56420`	F-box/FBD/LRR-repeat protein At5g56420.	No verified direct reference in this release
`At1g51370`	F-box/FBD/LRR-repeat protein At1g51370.	No verified direct reference in this release
`At4g10400`	FBD-associated F-box protein At4g10400.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021437 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT1G13570

ath:AT1G66300

ath:AT1G66310

ath:AT3G52680

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.713

Rank 1 · TkA05G394650 · TK1151

Cytoplasm0.391

Rank 2 · TkA05G394650 · TK1151

Endoplasmic reticulum0.055

Rank 3 · TkA05G394650 · TK1151

Cell membrane0.037

Rank 4 · TkA05G394650 · TK1151

Plastid0.030

Rank 5 · TkA05G394650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00646F-box9-44 aa

PF06540GMAP49-80 aa

PF08387FBD66-74 aa

PF23622LRR_At1g61320_AtMIF197-195 aa

PF24758LRR_At5g56370100-322 aa

PF29594LRR_SKP2158-190 aa

PF07723LRR_2159-181 aa

PF07723LRR_2257-263 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G394650	`PF00646`	F-box	9	44	1.2e-05	25.7
TkA05G394650	`PF06540`	GMAP	49	80	0.11	13.3
TkA05G394650	`PF08387`	FBD	66	74	4.6e-07	30.3
TkA05G394650	`PF23622`	LRR_At1g61320_AtMIF1	97	195	1.6e-08	35.1
TkA05G394650	`PF24758`	LRR_At5g56370	100	322	4.9e-23	82.7
TkA05G394650	`PF29594`	LRR_SKP2	158	190	0.13	12.2
TkA05G394650	`PF07723`	LRR_2	159	181	0.0014	19.9
TkA05G394650	`PF07723`	LRR_2	257	263	0.0014	19.9
TkA05G394650	`PF07723`	LRR_2	288	300	0.0014	19.9
TkA05G394650	`PF29594`	LRR_SKP2	292	330	0.13	12.2
TkA05G394650	`PF23622`	LRR_At1g61320_AtMIF1	297	383	1.6e-08	35.1
TkA05G394650	`PF24758`	LRR_At5g56370	341	387	4.9e-23	82.7
TkA05G394650	`PF08387`	FBD	341	384	4.6e-07	30.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FZ70`	Arabidopsis thaliana	sp\|Q9FZ70\|FDL1_ARATH F-box/FBD/LRR-repeat protein At1g13570	56.900%	Swiss-Prot	High
`Q9C8Y6`	Arabidopsis thaliana	sp\|Q9C8Y6\|FBD5_ARATH FBD-associated F-box protein At1g66310	26.100%	Swiss-Prot	Low
`Q9FM89`	Arabidopsis thaliana	sp\|Q9FM89\|FDL38_ARATH F-box/FBD/LRR-repeat protein At5g56420	25.300%	Swiss-Prot	Low
`Q6DBN6`	Arabidopsis thaliana	sp\|Q6DBN6\|FDL6_ARATH F-box/FBD/LRR-repeat protein At1g51370	25.000%	Swiss-Prot	Low
`Q9SV82`	Arabidopsis thaliana	sp\|Q9SV82\|FBD40_ARATH FBD-associated F-box protein At4g10400	24.600%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card