TkA05G391710 | RubberDandelionOmics

Gene overview

TkA05G391710

Reference: TK1151 Chr: Chr05 Coordinates: 97348617-97351051 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1785 bp · TkA05G391710|TK1151|cDNA

TTATCATCTTCTACGGCACACACATAAAAGCAAAGATTCATCATTGCTGCATATGTTCCAAGACAACCCAGAGAGAGAAATAGATTCAGCAAATTTTGGTCGCAAGTCGCAATCACCACCGATTAACATCAGCTCCAGATCCAAAATTAGTCCCGAGAAACTAATTTACAAGTTTCAGAAGAGTATTTGGACGATTAAGCTCCGATTCCTTCCCCTTCATGGTAGATCGATCAACTGATTTTTATTAATGATTTCTGGTT...

CDS

Download CDS FASTA

1437 bp · TkA05G391710|TK1151|CDS

ATGATTTCTGGTTATATGGAGAACAAAATGAGGATGAGGAACAAATACCGGAAACCAACCCCTTTAAATTGCTATGCAGGAACCAGATATAATAACTTATCAATCGCGGTATGCAGCCTCATAGGATGCCTAATTCTCTTCCACTTCTACTTCCTAAATCAAAGTCAACAAAGTCAACTCCAAGTCCCCCAAATGCAAACAACTCACCATCCATTATACCGCGAACTCATAGAAGTCGAAGATGACAACATTAAAATCCC...

Protein

Download Protein FASTA

478 aa · TkA05G391710|TK1151|PROTEIN

MISGYMENKMRMRNKYRKPTPLNCYAGTRYNNLSIAVCSLIGCLILFHFYFLNQSQQSQLQVPQMQTTHHPLYRELIEVEDDNIKIPPPRKRSPRAIKRKPKRPTTLIEEFLDESSQLRYLFFPGSKTAIDPMKNGGGNESFYYHPGRIWLDTDGNPIQAHGGGILYDERSSKYFWYGEYKDGPTYRAHKKAAARVDIIGVGCYSSKDLWTWKNEGIVLPAEQTNETHDLHISNVLERPKVIYNQNTNKYIMWMHIDDTN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G391710`
TK1151 ID	TkA05G391710
OH-1004 ID	LXL04_006698
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 98.954 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G391710`
Location	Chr05:97348617-97351051 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_006698` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.573

Rank 1 · TkA05G391710 · TK1151

Endoplasmic reticulum0.181

Rank 2 · TkA05G391710 · TK1151

Cytoplasm0.119

Rank 3 · TkA05G391710 · TK1151

Lysosome / Vacuole0.116

Rank 4 · TkA05G391710 · TK1151

Cell membrane0.088

Rank 5 · TkA05G391710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16396DUF5005162-280 aa

PF04616Glyco_hydro_43199-383 aa

PF00251Glyco_hydro_32N203-314 aa

PF16396DUF5005292-313 aa

PF16396DUF5005339-381 aa

PF00251Glyco_hydro_32N344-360 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G391710	`PF16396`	DUF5005	162	280	8.2e-05	23.2
TkA05G391710	`PF04616`	Glyco_hydro_43	199	383	4.5e-21	76.2
TkA05G391710	`PF00251`	Glyco_hydro_32N	203	314	0.035	14.4
TkA05G391710	`PF16396`	DUF5005	292	313	8.2e-05	23.2
TkA05G391710	`PF16396`	DUF5005	339	381	8.2e-05	23.2
TkA05G391710	`PF00251`	Glyco_hydro_32N	344	360	0.035	14.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card