TkA05G360380 | RubberDandelionOmics

Gene overview

TkA05G360380

Reference: TK1151 Chr: Chr05 Coordinates: 89458137-89464183 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4800 bp · TkA05G360380|TK1151|cDNA

TACCACCCAGCGTCCCAAGTTCAAACCCTTTTCTTCCATTTTCAAACGACCTCCTTCTACGATCATGAGCTAGGAACTGCTCGCATGAGACTGATTCCACCCATTTCTTCCGTTCTCTTCCTTGCTGATTTCGTGCTTCCCTGATTCCGGTGAGCGGTGTTTTGGTATTTCTTCCTGATCGAGACTCGAGAGAACTGCTGCCATCTTCTTCCTAAAATCAATTCCAGATTTGTTAATCATCAATCTTTCAGCATCGTATA...

CDS

Download CDS FASTA

4236 bp · TkA05G360380|TK1151|CDS

ATGTCTTGGGAAAACGAGATTGTAATGCGAGATATCACCAAAGCAAGTCATTTAGTGAGCAACCGCATCGTTAAAGACGTAGCGGCTCAGCTTGACCTAGAAGAGGCCCTGGAAGCGGCGAGATATACTAGCCATCCTTACTCTACTCACCCCAGAGAGTGGCCTCCTTTAGTTGAAGTGGTAGATACCAGGGAGTTGCCCCCAGTACTCATAGAAAGATACAATTCAGCTGGAGGTGAAGGCACTGCTTTATGTGGAAT...

Protein

Download Protein FASTA

1411 aa · TkA05G360380|TK1151|PROTEIN

MSWENEIVMRDITKASHLVSNRIVKDVAAQLDLEEALEAARYTSHPYSTHPREWPPLVEVVDTRELPPVLIERYNSAGGEGTALCGIFPEIRRAWASVDNSLFLWRFDKWDSQCPEYSGEEQAICAVGLVKAKPGIFVEAIQYLLVLATPVELLLIGVCCSGNGDGTDPYAEVSLQPLPEYTIPSDGVTMTCISCTNKGHIFMAGRDGHIYEMHYTTGSNWHKQCRKVCLTSGLGSVVSRWVVPNVFKFGAVDPIVEMTV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G360380`
TK1151 ID	TkA05G360380
OH-1004 ID	LXL04_021169
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.300
Protein coverage (%)	TK1151 99.929 / OH-1004 97.568 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G360380

Location Chr05:89458137-89464183 (+)

Description Similar to NUP155: Nuclear pore complex protein NUP155

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g14850`	Major component of the nuclear pore complex (NPC).	Genomic organization, transcript variants and comparative analysis of the human nucleoporin 155 (NUP155) gene.2002 · DOI: 10.1016/s0378-1119(02)00470-5

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021169 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000972 transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery Biological Process

GO:0006405 RNA export from nucleus Biological Process

GO:0006406 mRNA export from nucleus Biological Process

GO:0006606 protein import into nucleus Biological Process

GO:0006913 nucleocytoplasmic transport Biological Process

GO:0006998 nuclear envelope organization Biological Process

GO:0007015 actin filament organization Biological Process

GO:0007140 male meiotic nuclear division Biological Process

GO:0007281 germ cell development Biological Process

GO:0007283 spermatogenesis Biological Process

GO:0034504 protein localization to nucleus Biological Process

GO:0035196 miRNA processing Biological Process

KEGG gene cross-reference

ath:AT1G14850

dme:Dmel_CG4579

hsa:9631

mmu:170762

rno:117021

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.669

Rank 1 · TkA05G360380 · TK1151

Cytoplasm0.321

Rank 2 · TkA05G360380 · TK1151

Golgi apparatus0.064

Rank 3 · TkA05G360380 · TK1151

Lysosome / Vacuole0.056

Rank 4 · TkA05G360380 · TK1151

Cell membrane0.052

Rank 5 · TkA05G360380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08801Nucleoporin_N54-514 aa

PF03177Nucleoporin_C735-1355 aa

PF23737HTH_71843-876 aa

PF23737HTH_711218-1226 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G360380	`PF08801`	Nucleoporin_N	54	514	3.2e-76	257.5
TkA05G360380	`PF03177`	Nucleoporin_C	735	1355	5.8e-75	254.1
TkA05G360380	`PF23737`	HTH_71	843	876	0.26	12.0
TkA05G360380	`PF23737`	HTH_71	1218	1226	0.26	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4HXV6`	Arabidopsis thaliana	sp\|F4HXV6\|NU155_ARATH Nuclear pore complex protein NUP155	66.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card