TkA05G360320 | RubberDandelionOmics

Gene overview

TkA05G360320

Reference: TK1151 Chr: Chr05 Coordinates: 89437919-89438869 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

903 bp · TkA05G360320|TK1151|cDNA

ATGTCCATCAAAATCCCACCTACATCCCAACCCAAGGAACCGTTCCATCGCAGGAACGGTTCAGACGAGCTCGATGTGTTTGAGGCGGCTCATTATTTCTCAGGCACCACTGAAAACTTTAGTGTCGCTTGCAAAAACGTCAAGCGTATGGGGAGAATGAGTCTCGACATCCCAAAAAATATAGAGAATACCATTCCTTTGCAAGCCATGTTGATGGAGAATTCCATGAACAATGAGAAGAAATCCAAGCATCCAAGCTC...

CDS

Download CDS FASTA

903 bp · TkA05G360320|TK1151|CDS

ATGTCCATCAAAATCCCACCTACATCCCAACCCAAGGAACCGTTCCATCGCAGGAACGGTTCAGACGAGCTCGATGTGTTTGAGGCGGCTCATTATTTCTCAGGCACCACTGAAAACTTTAGTGTCGCTTGCAAAAACGTCAAGCGTATGGGGAGAATGAGTCTCGACATCCCAAAAAATATAGAGAATACCATTCCTTTGCAAGCCATGTTGATGGAGAATTCCATGAACAATGAGAAGAAATCCAAGCATCCAAGCTC...

Protein

Download Protein FASTA

300 aa · TkA05G360320|TK1151|PROTEIN

MSIKIPPTSQPKEPFHRRNGSDELDVFEAAHYFSGTTENFSVACKNVKRMGRMSLDIPKNIENTIPLQAMLMENSMNNEKKSKHPSSPGGRLAHFLNSLFNQTSSKKSQSKSKTKSTKSEDDSPGGWRRKRSSISHFRSGNSNSSISDSKSLYSTSKSSGFRTPPFYHIAHTPTKTGRSYLDLKQPPSQITKIPINGTLKRNESFNIKTDLSENKMSVETRFVENVKMYDEKQEEHHHPRKYVSREDVKGFKRFSDEDGG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G360320`
TK1151 ID	TkA05G360320
OH-1004 ID	LXL04_021168
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	94.300
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G360320

Location Chr05:89437919-89438869 (+)

Description Similar to At1g69160: Protein BIG GRAIN 1-like E

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g69160`	Involved in auxin transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021168 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009734 auxin-activated signaling pathway Biological Process

GO:0010929 positive regulation of auxin mediated signaling pathway Biological Process

GO:0060918 auxin transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G69160

ath:AT3G13980

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.423

Rank 1 · TkA05G360320 · TK1151

Nucleus0.416

Rank 2 · TkA05G360320 · TK1151

Cytoplasm0.367

Rank 3 · TkA05G360320 · TK1151

Endoplasmic reticulum0.051

Rank 4 · TkA05G360320 · TK1151

Plastid0.026

Rank 5 · TkA05G360320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05602CLPTM136-153 aa

PF30505Big_grain_166-114 aa

PF05602CLPTM1191-226 aa

PF30505Big_grain_1255-297 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G360320	`PF05602`	CLPTM1	36	153	0.5	10.0
TkA05G360320	`PF30505`	Big_grain_1	66	114	7.8e-07	29.8
TkA05G360320	`PF05602`	CLPTM1	191	226	0.5	10.0
TkA05G360320	`PF30505`	Big_grain_1	255	297	7.8e-07	29.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q93Z37`	Arabidopsis thaliana	sp\|Q93Z37\|BIG1E_ARATH Protein BIG GRAIN 1-like E	31.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card