TkA05G359440 | RubberDandelionOmics

Gene overview

TkA05G359440

Reference: TK1151 Chr: Chr05 Coordinates: 89229284-89231974 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1717 bp · TkA05G359440|TK1151|cDNA

TCCACTCAGAAAAGAAATAAACCAGCATTTACTGAAGGAGAAAAGAAAGAAATTAATGCAACTGAATTGTCTCATCCAAAACCTCCATCGTTGATGATATATTGCAAATCAAGATCACAGATTACCGATCAATCCCATCCATCGCCCTCGTACTCTCTCTGCAATTCTGTTTCTTCCAAAATGCCCTAATTTTCACCGTCTAAACGATGAAGATAAAGATGAAGATGCCATTTACTTTTGTTCTTGTTCGAAAGTAGGGT...

CDS

Download CDS FASTA

792 bp · TkA05G359440|TK1151|CDS

ATGGAATCGCACAAAGACAGGGGCGAAGTAAGAATCCATGAAAATTTAGATGAACTCAGTACCGATTTGGCTGATTACGTGGCAGAATTATCGGAGGCATCTGTGAAAGAGCGTGGCGTTTTCGCCATTGCTCTATCTGGTGGTTCTCTCATTAGCTTAATGAGGAATCTATGTGGAGCTCCTTATAACAAGACTGTAGATTGGTCCAAATGGTATATATTTTGGGCCGATGAACGTGTGGTTGCCAAAAATCACGTCGA...

Protein

Download Protein FASTA

263 aa · TkA05G359440|TK1151|PROTEIN

MESHKDRGEVRIHENLDELSTDLADYVAELSEASVKERGVFAIALSGGSLISLMRNLCGAPYNKTVDWSKWYIFWADERVVAKNHVDSNYKLAKDHLLSKLPIVPSHVHSINDSLTAEEAANEYEFVIRQLVRTRVINVSDISDFPKFDLILLGMGPDGHVASLFPNHSVLEEKNEWVTFITTSPKPPPERITFTLPVINSAANVAVVVTGGGKAEAARLAIDGVGPECEGLPARMIEPVVGKLVWFLDNQAGSKLKSFS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G359440`
TK1151 ID	TkA05G359440
OH-1004 ID	LXL04_021165
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 93.262 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G359440

Location Chr05:89229284-89231974 (+)

Description Similar to PGL1: Probable 6-phosphogluconolactonase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g13700`	Catalyzes the hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2YNH4`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`Os07g0604000`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`UniProt: A2XI04`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release
`Os03g0416500`	Hydrolysis of 6-phosphogluconolactone to 6-phosphogluconate.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021165 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005975 carbohydrate metabolic process Biological Process

GO:0006098 pentose-phosphate shunt Biological Process

GO:0009051 pentose-phosphate shunt, oxidative branch Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0017057 6-phosphogluconolactonase activity Molecular Function

KEGG gene cross-reference

ath:AT1G13700

dosa:Os03g0416500

dosa:Os07g0604000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.799

Rank 1 · TkA05G359440 · TK1151

Nucleus0.454

Rank 2 · TkA05G359440 · TK1151

Mitochondrion0.056

Rank 3 · TkA05G359440 · TK1151

Peroxisome0.044

Rank 4 · TkA05G359440 · TK1151

Endoplasmic reticulum0.033

Rank 5 · TkA05G359440 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01182Glucosamine_iso16-246 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G359440	`PF01182`	Glucosamine_iso	16	246	1.1e-73	248.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMX8`	Arabidopsis thaliana	sp\|Q9LMX8\|6PGL1_ARATH Probable 6-phosphogluconolactonase 1	68.300%	Swiss-Prot	High
`A2YNH4`	Oryza sativa subsp. indica	sp\|A2YNH4\|6PGL2_ORYSI Probable 6-phosphogluconolactonase 2	65.100%	Swiss-Prot	High
`Q6Z4H0`	Oryza sativa subsp. japonica	sp\|Q6Z4H0\|6PGL2_ORYSJ Probable 6-phosphogluconolactonase 2	65.100%	Swiss-Prot	High
`A2XI04`	Oryza sativa subsp. indica	sp\|A2XI04\|6PGL1_ORYSI Probable 6-phosphogluconolactonase 1	65.200%	Swiss-Prot	High
`Q75IV7`	Oryza sativa subsp. japonica	sp\|Q75IV7\|6PGL1_ORYSJ Probable 6-phosphogluconolactonase 1	65.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card