TkA05G352180 | RubberDandelionOmics

Gene overview

TkA05G352180

Reference: TK1151 Chr: Chr05 Coordinates: 87211965-87217057 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2131 bp · TkA05G352180|TK1151|cDNA

CTGAATGTGATAGAATCTATAAAACACAGGGACCATTCGTGAAATTTTGTCTATTTTAATTTAAATACGCACTCCATATGAAGGAGCCGAATGGCAATTGATAGTAATCGAGGGGTGAAACTACAAATTAGGAAACATGTGAGGGGCAGCGAGGAAAACCCAAATATGGAAATATCTTCCGGAAGCCTTTTTCGTATCTGCTCCGTGGACTTTTTACTGATTTTGCTGATCATCTGAATACAGACATTAAAACAATCCCC...

CDS

Download CDS FASTA

1515 bp · TkA05G352180|TK1151|CDS

ATGGATGAAAAGAGGGGATTATCTTTGTCGGACCCGTCTACACGGCCTTCAATAACGCTCCCGGCACGTTCGACAGTCGAGACTTTGTTCACTGGTGGAGGCAGCGGTACGGGAGCTAGTCCTGGACCAATGACTTTGGTCTCAAATTTCTTCTCGGAGAACGATCCTGATTCAGATTGTCGTTCATTCTCTCAGCTTTTATCGGGAGCTATGCTGTCGCCGGCCGAAATTCCTAATCGTAGACCGTCGAGTCATCTGGA...

Protein

Download Protein FASTA

504 aa · TkA05G352180|TK1151|PROTEIN

MDEKRGLSLSDPSTRPSITLPARSTVETLFTGGGSGTGASPGPMTLVSNFFSENDPDSDCRSFSQLLSGAMLSPAEIPNRRPSSHLDMGHYYSHKESVNNGGVGSGGGGGGNVDFQFSNNGRPSSLVVTQPSMFTIPPGLSPATLLDSPGFFPQNQASLGMSHQQALAQVTAHASSLPPIHSFTSTTATTTTTTTYHRQPPPMADHTTASDYQPSSIAVDKPADDGYNWRKYGQKQVKGSEYPRSYYKCTHPNCPVKKQV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G352180`
TK1151 ID	TkA05G352180
OH-1004 ID	LXL04_021082
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G352180

Location Chr05:87211965-87217057 (+)

Description Similar to WRKY3: Probable WRKY transcription factor 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g03340`	Transcription factor.	No verified direct reference in this release
`At1g13960`	Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.	Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68 Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844
`At3g01080`	Transcription factor.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0826400`	May participate in transcriptional regulation of abscisic acid and gibberellin signaling.	Annotations and functional analyses of the rice WRKY gene superfamily reveal positive and negative regulators of abscisic acid signaling in aleurone cells.2005 · DOI: 10.1104/pp.104.054312 A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.2009 · DOI: 10.1007/s11103-009-9463-4
`UniProt: Q6B6R4`	Transcription repressor (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021082 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009409 response to cold Biological Process

GO:0009555 pollen development Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009740 gibberellic acid mediated signaling pathway Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

KEGG gene cross-reference

ath:AT1G13960

ath:AT2G03340

ath:AT3G01080

ath:AT4G26440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.965

Rank 1 · TkA05G352180 · TK1151

Cytoplasm0.147

Rank 2 · TkA05G352180 · TK1151

Cell membrane0.016

Rank 3 · TkA05G352180 · TK1151

Mitochondrion0.015

Rank 4 · TkA05G352180 · TK1151

Endoplasmic reticulum0.007

Rank 5 · TkA05G352180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106WRKY224-280 aa

PF03106WRKY386-443 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G352180	`PF03106`	WRKY	224	280	2e-54	182.4
TkA05G352180	`PF03106`	WRKY	386	443	2e-54	182.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZQ70`	Arabidopsis thaliana	sp\|Q9ZQ70\|WRKY3_ARATH Probable WRKY transcription factor 3	52.000%	Swiss-Prot	High
`Q9XI90`	Arabidopsis thaliana	sp\|Q9XI90\|WRKY4_ARATH Probable WRKY transcription factor 4	54.500%	Swiss-Prot	High
`Q93WU7`	Arabidopsis thaliana	sp\|Q93WU7\|WRK58_ARATH Probable WRKY transcription factor 58	57.200%	Swiss-Prot	Low
`Q6IEQ7`	Oryza sativa subsp. japonica	sp\|Q6IEQ7\|WRK24_ORYSJ WRKY transcription factor WRKY24	41.500%	Swiss-Prot	Medium
`Q6B6R4`	Oryza sativa subsp. indica	sp\|Q6B6R4\|WRK24_ORYSI WRKY transcription factor WRKY24	41.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card