TkA05G346410 | RubberDandelionOmics

Gene overview

TkA05G346410

Reference: TK1151 Chr: Chr05 Coordinates: 85869029-85871515 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1018 bp · TkA05G346410|TK1151|cDNA

ATTATATTGGTCTTTGTTTTAAAATGTTTTATGATAAACTATGTACAAACACCTCTCCCCTTTCCCTCTTCTGACCGAATCGGAGGGTTTTTTACTTATTAGAACCTAGAAGGCTCTGAAGTCTGAACGATTAGGTACGTGGATAAATCGTTGCATTTCTTGAACTGCCCTAGTTTGCCATCCAACGTAAACATATCGGATTGCTCTTTTCCCACACCGGCACCAACTGCTTCTTACCTACACCGGCGACAACTCCTCCT...

CDS

Download CDS FASTA

540 bp · TkA05G346410|TK1151|CDS

ATGCAGACACTTGGCGAACATAAGTTGCCCCACTTCTTTAACTATCCGCCATACTTCACGTTGCAGCCAGTGAGAGAAACCCGAGAGAAACAAATACAAGTATGGAAGGAACTTATTCTTGATTATTGTCGAACACAAAAAATATTCATTATTGGATTGGAACAAGACTTTCCCCTCTTCTCCAATCCCGCAATAGAAAGGTCTTTGAATCATGAAGCAAGAGAAGCTTTTCTTTCAGCTTTAGTTTTGGATGGACGTGC...

Protein

Download Protein FASTA

179 aa · TkA05G346410|TK1151|PROTEIN

MQTLGEHKLPHFFNYPPYFTLQPVRETREKQIQVWKELILDYCRTQKIFIIGLEQDFPLFSNPAIERSLNHEAREAFLSALVLDGRAEWMDKSHRQCLILWHRIKDWADIILRFVNENGLEDSVMTIEEIRSGIESRGTDIHGMDRTVLMRALKLLENKGKLAIFKGTSTDDEGVKFSV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G346410`
TK1151 ID	TkA05G346410
OH-1004 ID	LXL04_021051
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G346410

Location Chr05:85869029-85871515 (-)

Description Similar to VPS25: Vacuolar protein sorting-associated protein 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g19003`	Component of the ESCRT-II complex (endosomal sorting complex required for transport II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021051 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0007175 negative regulation of epidermal growth factor-activated receptor activity Biological Process

GO:0016236 macroautophagy Biological Process

GO:0036258 multivesicular body assembly Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0090148 membrane fission Biological Process

GO:0000814 ESCRT II complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT4G19003

hsa:84313

mmu:28084

xla:447248

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.594

Rank 1 · TkA05G346410 · TK1151

Cytoplasm0.544

Rank 2 · TkA05G346410 · TK1151

Cell membrane0.038

Rank 3 · TkA05G346410 · TK1151

Endoplasmic reticulum0.037

Rank 4 · TkA05G346410 · TK1151

Lysosome / Vacuole0.035

Rank 5 · TkA05G346410 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05871ESCRT-II12-145 aa

PF25880WHD_CHMP7_1st29-54 aa

PF25880WHD_CHMP7_1st103-138 aa

PF24101WHD_GTF3C1110-171 aa

PF00392GntR143-170 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G346410	`PF05871`	ESCRT-II	12	145	1.7e-46	158.6
TkA05G346410	`PF25880`	WHD_CHMP7_1st	29	54	0.00025	21.5
TkA05G346410	`PF25880`	WHD_CHMP7_1st	103	138	0.00025	21.5
TkA05G346410	`PF24101`	WHD_GTF3C1	110	171	0.02	15.3
TkA05G346410	`PF00392`	GntR	143	170	0.1	13.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VZC9`	Arabidopsis thaliana	sp\|Q8VZC9\|VPS25_ARATH Vacuolar protein sorting-associated protein 25	79.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card