TkA05G313370 | RubberDandelionOmics

Gene overview

TkA05G313370

Reference: TK1151 Chr: Chr05 Coordinates: 77348978-77350263 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1124 bp · TkA05G313370|TK1151|cDNA

GGGTGTTATTGTTTTAAATCTCCGCATCTCTATGGACCGTTTCTACTCATTTCTCCGAGATACCCTGCTTGAAATAGGCGACTCAGTTTTGAAACATTTCTTGCGATTACATAAATCTTGATCATCTCTTAGATCCCTCTCATCTGTTCTCTTTCTCTAAACCCTAAAAGCTACCGCCATCATCTGCCTTCGTTTCTCCAATAACTACGCAAACCATCACTGTTGCCTCAATTGTTGTTGCGACACAGGTTCCTCGAGCA...

CDS

Download CDS FASTA

450 bp · TkA05G313370|TK1151|CDS

ATGAAAGAGAGGTCCTCTGGTTTGATCATCGGGATCTCAATAGGAGTAGTAATCGGAGCCCTCTTAGCCTTAATCGTTCTACTCTGCTTCAGATATCACCGTAAACGACCTCAAATCGGACCTCAAATCGGCAACAGCAGTTCCAGAAGAGCATCAACCATCCCCCTTCTTATGCCACAAAAATCGCCACCTACTGATTCAATCGTCCAGGATTCTTCAGCCACAAAATCTACCAACCTACTCATCAAAGCTTGGGAAGA...

Protein

Download Protein FASTA

149 aa · TkA05G313370|TK1151|PROTEIN

MKERSSGLIIGISIGVVIGALLALIVLLCFRYHRKRPQIGPQIGNSSSRRASTIPLLMPQKSPPTDSIVQDSSATKSTNLLIKAWEESERSKIDNKAEKKLAAIGAWENSKKAELEADRSNGTCIQERITSQFQCLTNYNIGIVPVSIS

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G313370`
TK1151 ID	TkA05G313370
OH-1004 ID	LXL04_016406
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	66.100
Protein coverage (%)	TK1151 37.584 / OH-1004 11.685 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G313370

Location Chr05:77348978-77350263 (-)

Description Similar to CRLK1: Calcium/calmodulin-regulated receptor-like kinase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23750`	Remorin 1.4.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_016406 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006952 defense response Biological Process

GO:0007165 signal transduction Biological Process

GO:0009409 response to cold Biological Process

GO:0009631 cold acclimation Biological Process

GO:0010183 pollen tube guidance Biological Process

GO:0010483 pollen tube reception Biological Process

GO:0031349 positive regulation of defense response Biological Process

GO:0045087 innate immune response Biological Process

GO:0045088 regulation of innate immune response Biological Process

GO:0005634 nucleus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

KEGG gene cross-reference

ath:AT1G20650

ath:AT3G07070

ath:AT3G24790

ath:AT5G15730

ath:AT5G54590

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.355

Rank 1 · TkA05G313370 · TK1151

Nucleus0.236

Rank 2 · TkA05G313370 · TK1151

Cytoplasm0.197

Rank 3 · TkA05G313370 · TK1151

Endoplasmic reticulum0.151

Rank 4 · TkA05G313370 · TK1151

Plastid0.099

Rank 5 · TkA05G313370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27822SIGLECL1_C5-36 aa

PF29006TMEM81_C5-28 aa

PF27946C1orf1626-87 aa

PF02439Adeno_E3_CR27-38 aa

PF26472DUF81478-35 aa

PF03763Remorin_C81-118 aa

PF27822SIGLECL1_C95-106 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G313370	`PF27822`	SIGLECL1_C	5	36	0.073	13.7
TkA05G313370	`PF29006`	TMEM81_C	5	28	0.22	12.3
TkA05G313370	`PF27946`	C1orf162	6	87	0.17	12.4
TkA05G313370	`PF02439`	Adeno_E3_CR2	7	38	0.0085	16.6
TkA05G313370	`PF26472`	DUF8147	8	35	0.1	13.5
TkA05G313370	`PF03763`	Remorin_C	81	118	1.2e-10	41.8
TkA05G313370	`PF27822`	SIGLECL1_C	95	106	0.073	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FFA5`	Arabidopsis thaliana	sp\|Q9FFA5\|RMR14_ARATH Remorin 1.4	68.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card