TkA05G282250 | RubberDandelionOmics

Gene overview

TkA05G282250

Reference: TK1151 Chr: Chr05 Coordinates: 69792059-69793396 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

519 bp · TkA05G282250|TK1151|cDNA

ATGGCTTATTTGCAGGGTTTGAGAAGAGAAGATCCATTGGCAAATGGTGAGAAGAATGATCTCGCGCTTAGAGATGCAGTGCAGGCTGCAAATGTGAGTAACGTCCCAGTTTTGTGTCTGGCAAAAACAGAGGCAGGGAGATTGATCATTGGTACTATCGCTTTGTTGACTGCATGCACATCAAGTATTCTGATTGAAATAGCTTTCTTTGATATTACAAGAACTGGGGAGCTGCTTAGTAGACTTTCTGAAGATACCCA...

CDS

Download CDS FASTA

519 bp · TkA05G282250|TK1151|CDS

ATGGCTTATTTGCAGGGTTTGAGAAGAGAAGATCCATTGGCAAATGGTGAGAAGAATGATCTCGCGCTTAGAGATGCAGTGCAGGCTGCAAATGTGAGTAACGTCCCAGTTTTGTGTCTGGCAAAAACAGAGGCAGGGAGATTGATCATTGGTACTATCGCTTTGTTGACTGCATGCACATCAAGTATTCTGATTGAAATAGCTTTCTTTGATATTACAAGAACTGGGGAGCTGCTTAGTAGACTTTCTGAAGATACCCA...

Protein

Download Protein FASTA

172 aa · TkA05G282250|TK1151|PROTEIN

MAYLQGLRREDPLANGEKNDLALRDAVQAANVSNVPVLCLAKTEAGRLIIGTIALLTACTSSILIEIAFFDITRTGELLSRLSEDTQIIKNAATSNVSEILRNLSTAFIGLGFMFATSWKLTLLALVVVPGISIAVREVGRYLREVSHKTQTAAAVVSLIAELTKCSRGENE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G282250`
TK1151 ID	TkA05G282250
OH-1004 ID	LXL04_000796
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	95.900
Protein coverage (%)	TK1151 100.000 / OH-1004 55.128 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G282250

Location Chr05:69792059-69793396 (+)

Description Similar to ABCB25: ABC transporter B family member 25

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g39040`	Probably involved in redistribution of internalized aluminum.	Arabidopsis ALS1 encodes a root tip and stele localized half type ABC transporter required for root growth in an aluminum toxic environment.2007 · DOI: 10.1007/s00425-006-0452-4

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0755100`	Metal transporter involved in the sequestration of aluminum into vacuoles, which is required for cellular detoxification of aluminum.	A tonoplast-localized half-size ABC transporter is required for internal detoxification of aluminum in rice.2012 · DOI: 10.1111/j.1365-313x.2011.04837.x

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_000796 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006783 heme biosynthetic process Biological Process

GO:0006839 mitochondrial transport Biological Process

GO:0010044 response to aluminum ion Biological Process

GO:0034514 mitochondrial unfolded protein response Biological Process

GO:0055085 transmembrane transport Biological Process

GO:0070455 positive regulation of heme biosynthetic process Biological Process

GO:0090374 oligopeptide export from mitochondrion Biological Process

GO:0140982 detoxification of aluminum ion Biological Process

GO:0170037 export from the mitochondrion Biological Process

GO:1902602 aluminum ion transmembrane transport Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005739 mitochondrion Cellular Component

KEGG gene cross-reference

ath:AT5G39040

dosa:Os03g0755100

hsa:23456

mmu:56199

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.274

Rank 1 · TkA05G282250 · TK1151

Lysosome / Vacuole0.221

Rank 2 · TkA05G282250 · TK1151

Cell membrane0.154

Rank 3 · TkA05G282250 · TK1151

Cytoplasm0.153

Rank 4 · TkA05G282250 · TK1151

Peroxisome0.099

Rank 5 · TkA05G282250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13978DUF422348-63 aa

PF00664ABC_membrane65-161 aa

PF11073NSs67-135 aa

PF13978DUF4223128-134 aa

PF13978DUF4223151-167 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G282250	`PF13978`	DUF4223	48	63	1.6	9.4
TkA05G282250	`PF00664`	ABC_membrane	65	161	8.7e-21	75.5
TkA05G282250	`PF11073`	NSs	67	135	0.25	11.5
TkA05G282250	`PF13978`	DUF4223	128	134	1.6	9.4
TkA05G282250	`PF13978`	DUF4223	151	167	1.6	9.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WML0`	Arabidopsis thaliana	sp\|Q0WML0\|AB27B_ARATH ABC transporter B family member 27	43.500%	Swiss-Prot	Medium
`Q9FNU2`	Oryza sativa subsp. japonica	sp\|Q9FNU2\|AB25B_ORYSJ ABC transporter B family member 25	81.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card