RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G279420
Reference: TK1151 Chr: Chr05 Coordinates: 69080167-69086078 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

741 bp · TkA05G279420|TK1151|cDNA

ATGTGGGGGTTGAAGGTAGCCGAACCTGGTAATAAACAGTCGTATGTGACGGCATTGCAGGCTGCTAGACTGCTGGTAATAGTTTACGCACTTATAATGAATTATGATGATCGATTCTGCCAGATTGTTATTACTGTGACTTTGAATTCTAATTTGCCTAAAATATGGACAACCATCGGCCATATTTGTCGGCGACACACAGTTCTTCAATTGAGATGGTTCACTTATTTAAACTTTGATTTCAAAAAAGGAGGGTGGTC...

CDS

Download CDS FASTA

741 bp · TkA05G279420|TK1151|CDS

ATGTGGGGGTTGAAGGTAGCCGAACCTGGTAATAAACAGTCGTATGTGACGGCATTGCAGGCTGCTAGACTGCTGGTAATAGTTTACGCACTTATAATGAATTATGATGATCGATTCTGCCAGATTGTTATTACTGTGACTTTGAATTCTAATTTGCCTAAAATATGGACAACCATCGGCCATATTTGTCGGCGACACACAGTTCTTCAATTGAGATGGTTCACTTATTTAAACTTTGATTTCAAAAAAGGAGGGTGGTC...

Protein

Download Protein FASTA

246 aa · TkA05G279420|TK1151|PROTEIN

MWGLKVAEPGNKQSYVTALQAARLLVIVYALIMNYDDRFCQIVITVTLNSNLPKIWTTIGHICRRHTVLQLRWFTYLNFDFKKGGWSHEDDMLLCEAQKIFGNRWTEIAKRITSLISFKGQCRRRWFTYLNFDFKKGGWSHEDDMLLCEAQKIFGNRWTEIAKRITSLNLKFCAFTTKAKIRVVAWEHTVSATIMIPMSMWELLLSFVLKEEANDYIIHLSTLYSQRAFVKYHLPLRKLLLTFTMN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G279420
TK1151 IDTkA05G279420
OH-1004 IDLXL04_020645
Relationship / confidenceRbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)80.800
Protein coverage (%)TK1151 90.244 / OH-1004 88.772
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G279420
LocationChr05:69080167-69086078 (-)
DescriptionSimilar to MYB124: Transcription factor MYB124
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g14350 Transcription factor that binds to DNA in promoters cis- regulatory element 5'-GGCGCGC-3' of cell cycle genes, including cyclins, cyclin-dependent kinases (CDKs), and components of the pre- replication complex.
Developmental regulation of CYCA2s contributes to tissue-specific proliferation in Arabidopsis.2011 · DOI: 10.1038/emboj.2011.240
At2g02820 Transcription factor that binds to DNA in promoters cis- regulatory element 5'-GGCGCGC-3' of cell cycle genes, including cyclins, cyclin-dependent kinases (CDKs), and components of the pre- replication complex.
The Arabidopsis R2R3 MYB proteins FOUR LIPS and MYB88 restrict divisions late in the stomatal cell lineage.2005 · DOI: 10.1105/tpc.105.034116
Regulation of cell proliferation in the stomatal lineage by the Arabidopsis MYB FOUR LIPS via direct targeting of core cell cycle genes.2010 · DOI: 10.1105/tpc.110.074609
Role of the stomatal development regulators FLP/MYB88 in abiotic stress responses.2010 · DOI: 10.1111/j.1365-313x.2010.04364.x
Developmental regulation of CYCA2s contributes to tissue-specific proliferation in Arabidopsis.2011 · DOI: 10.1038/emboj.2011.240
FOUR LIPS and MYB88 conditionally restrict the G1/S transition during stomatal formation.2013 · DOI: 10.1093/jxb/ert313
Deep functional redundancy between FAMA and FOUR LIPS in stomatal development.2014 · DOI: 10.1111/tpj.12489
Requirement for A-type cyclin-dependent kinase and cyclins for the terminal division in the stomatal lineage of Arabidopsis.2014 · DOI: 10.1093/jxb/eru139
Transcriptional regulation of PIN genes by FOUR LIPS and MYB88 during Arabidopsis root gravitropism.2015 · DOI: 10.1038/ncomms9822

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_020645 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000278 mitotic cell cycle Biological Process
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0009553 embryo sac development Biological Process
GO:0009554 megasporogenesis Biological Process
GO:0009629 response to gravity Biological Process
GO:0009733 response to auxin Biological Process
GO:0009734 auxin-activated signaling pathway Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009926 auxin polar transport Biological Process
GO:0010052 guard cell differentiation Biological Process
GO:0010235 guard mother cell cytokinesis Biological Process
KEGG gene cross-reference
ath:AT1G14350
ath:AT2G02820
hsa:4605
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.455
Rank 1 · TkA05G279420 · TK1151
Nucleus0.420
Rank 2 · TkA05G279420 · TK1151
Mitochondrion0.154
Rank 3 · TkA05G279420 · TK1151
Endoplasmic reticulum0.054
Rank 4 · TkA05G279420 · TK1151
Cell membrane0.047
Rank 5 · TkA05G279420 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14108ABA4-like2-91 aa
PF27874Mob_CxxC_CxxC16-75 aa
PF24120SsdA_C55-66 aa
PF13921Myb_DNA-bind_656-94 aa
PF00249Myb_DNA-binding69-77 aa
PF29045YOL036W_C70-100 aa
PF00249Myb_DNA-binding83-130 aa
PF11626Rap1_C83-102 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G279420PF14108ABA4-like2910.07514.1
TkA05G279420PF27874Mob_CxxC_CxxC16750.02415.4
TkA05G279420PF24120SsdA_C55660.05914.6
TkA05G279420PF13921Myb_DNA-bind_656941.2e-1145.4
TkA05G279420PF00249Myb_DNA-binding69771.2e-1454.8
TkA05G279420PF29045YOL036W_C701000.002818.1
TkA05G279420PF00249Myb_DNA-binding831301.2e-1454.8
TkA05G279420PF11626Rap1_C831020.311.9
TkA05G279420PF24120SsdA_C851190.05914.6
TkA05G279420PF13921Myb_DNA-bind_6861471.2e-1145.4
TkA05G279420PF14108ABA4-like1111440.07514.1
TkA05G279420PF29045YOL036W_C1271540.002818.1
TkA05G279420PF00249Myb_DNA-binding1361661.2e-1454.8
TkA05G279420PF11626Rap1_C1361510.311.9
TkA05G279420PF24120SsdA_C1381650.05914.6
TkA05G279420PF13921Myb_DNA-bind_61391731.2e-1145.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q94FL6Arabidopsis thalianasp|Q94FL6|MY124_ARATH Transcription factor MYB12456.100%Swiss-ProtLow
F4IRB4Arabidopsis thalianasp|F4IRB4|MYB88_ARATH Transcription factor MYB8844.800%Swiss-ProtLow

JBrowse

View in Genome Browser