TkA05G168250 | RubberDandelionOmics

Gene overview

TkA05G168250

Reference: TK1151 Chr: Chr05 Coordinates: 43247382-43255122 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2376 bp · TkA05G168250|TK1151|cDNA

TATGATCGATAAAATTTCTGCTCTGTCATTCTTTCAAGTCGATTTGCAGTCATAAAACTTGTGCTCGTGAATTCTTTAATTCAATTTAGTCTCGTGGTTGGAAACTTGGAAATGATGGTTGAGTTTTAAGTTGGTGTATTTGGGTAAAGAAGATGTCTTCAGTGAGCAAAACTAGAAATATGATCGAGGAGTTTGTGAGAGATGGATCATTTAAATGGCTGTTGAAGAATCGAAGTCCATTTCATGAAGAGTTTGAGGAG...

CDS

Download CDS FASTA

2034 bp · TkA05G168250|TK1151|CDS

ATGTCTTCAGTGAGCAAAACTAGAAATATGATCGAGGAGTTTGTGAGAGATGGATCATTTAAATGGCTGTTGAAGAATCGAAGTCCATTTCATGAAGAGTTTGAGGAGATGAAAATGTCTCCATCTGCTGACAAAAACTGGATACACGAGCTGTCGCCTGTTGCAAATATAGTTGTTCGTCGATGTTCAAAAATTTTGGAGATTCCTACGGGGGAGCTTCGGGAAAAGTTTAATAGGGAGGCTCCGGATGGTATAAAAGA...

Protein

Download Protein FASTA

677 aa · TkA05G168250|TK1151|PROTEIN

MSSVSKTRNMIEEFVRDGSFKWLLKNRSPFHEEFEEMKMSPSADKNWIHELSPVANIVVRRCSKILEIPTGELREKFNREAPDGIKEASVYARNFLEYSCFRALAVFTQKSSYMEDKKFRRLIFDMMLAWEVPDAATQPSIDIDEDASVGIEAFSRIAAAVPIIANVIISDYIFEYLTASTASRLLFSTFDKYLNGLERAVRKVKSQSESSALSSHRSGRGERILELDGTVTTQPVCQHLGISTWLGRLTLTDHAMYFEP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G168250`
TK1151 ID	TkA05G168250
OH-1004 ID	LXL04_020318
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G168250`
Location	Chr05:43247382-43255122 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_020318` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.513

Rank 1 · TkA05G168250 · TK1151

Golgi apparatus0.227

Rank 2 · TkA05G168250 · TK1151

Nucleus0.143

Rank 3 · TkA05G168250 · TK1151

Cytoplasm0.131

Rank 4 · TkA05G168250 · TK1151

Cell membrane0.126

Rank 5 · TkA05G168250 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14628DUF4454388-421 aa

PF14628DUF4454437-471 aa

PF04842DUF639443-668 aa

PF06398Pex24p486-631 aa

PF02453Reticulon487-553 aa

PF02453Reticulon496-632 aa

PF08507COPI_assoc516-555 aa

PF08507COPI_assoc612-628 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G168250	`PF14628`	DUF4454	388	421	0.15	12.7
TkA05G168250	`PF14628`	DUF4454	437	471	0.15	12.7
TkA05G168250	`PF04842`	DUF639	443	668	3.1e-75	253.3
TkA05G168250	`PF06398`	Pex24p	486	631	0.00053	19.9
TkA05G168250	`PF02453`	Reticulon	487	553	0.079	13.6
TkA05G168250	`PF02453`	Reticulon	496	632	0.079	13.6
TkA05G168250	`PF08507`	COPI_assoc	516	555	0.25	12.1
TkA05G168250	`PF08507`	COPI_assoc	612	628	0.25	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card