TkA05G159850 | RubberDandelionOmics

Gene overview

TkA05G159850

Reference: TK1151 Chr: Chr05 Coordinates: 41227356-41233032 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2204 bp · TkA05G159850|TK1151|cDNA

ACAAATCAAGTAAATAAAGAAAAACGAAAAGGAAGCTTGGCTAGCGTTTTGTTGTGTATATATACGGACGATTGGGAAGCCTTGTTATGTATCGGAGTTTGCCATTAAGATAATATGGGGAAGCAGTTTTACGTTTCACCATCCGTTTTAGTTGTACTACTGCTTGCCACAGTTGTACCTTCTTGTTCATCTTCCAGCAACTCTAGACGCTTTCACTTCGATGTCCAATGGAAGAACATAAGTCGTTTATGCAGTAGAAA...

CDS

Download CDS FASTA

1743 bp · TkA05G159850|TK1151|CDS

ATGGGGAAGCAGTTTTACGTTTCACCATCCGTTTTAGTTGTACTACTGCTTGCCACAGTTGTACCTTCTTGTTCATCTTCCAGCAACTCTAGACGCTTTCACTTCGATGTCCAATGGAAGAACATAAGTCGTTTATGCAGTAGAAAAGCCATACTGACAGTGAATGGGGAGTTTCCAGGGCCAACAATTGCTGTAAATGAAGGAGAGAATGTGGAGATTAAGGTTACTAATGGAGTTTCTTTAAACACCACTATCCATTG...

Protein

Download Protein FASTA

580 aa · TkA05G159850|TK1151|PROTEIN

MGKQFYVSPSVLVVLLLATVVPSCSSSSNSRRFHFDVQWKNISRLCSRKAILTVNGEFPGPTIAVNEGENVEIKVTNGVSLNTTIHWHGIKQLRSGWADGPAYVTQCPIKPGQSYTYKFTVIGQRGTLWWHAHIAWQRATIYGAIIIYPRMPYPFSTPIAEEIPIIFGEWWNLPVEGIETEMNKYGNGPNSSDAYTINGLPGLLYPCAYKDTFIQTVERGKTYMLRIINAALNDELFFSIANHTLTVVEIDASYTKPFDT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G159850`
TK1151 ID	TkA05G159850
OH-1004 ID	LXL04_020278
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G159850

Location Chr05:41227356-41233032 (-)

Description Similar to LAC1: Laccase-1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g18140`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`At5g03260`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0842400`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os05g0458500`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release
`Os05g0458600`	Lignin degradation and detoxification of lignin-derived products.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020278 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009414 response to water deprivation Biological Process

GO:0009698 phenylpropanoid metabolic process Biological Process

GO:0009809 lignin biosynthetic process Biological Process

GO:0046274 lignin catabolic process Biological Process

GO:0080022 primary root development Biological Process

GO:0080112 seed growth Biological Process

GO:0005576 extracellular region Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0048046 apoplast Cellular Component

GO:0048226 Casparian strip Cellular Component

GO:0005507 copper ion binding Molecular Function

GO:0016491 oxidoreductase activity Molecular Function

KEGG gene cross-reference

ath:AT1G18140

ath:AT2G29130

ath:AT5G60020

dosa:Os01g0842400

dosa:Os05g0458600

osa:4339003

osa:4339004

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Extracellular0.835

Rank 1 · TkA05G159850 · TK1151

Cell membrane0.060

Rank 2 · TkA05G159850 · TK1151

Cytoplasm0.054

Rank 3 · TkA05G159850 · TK1151

Endoplasmic reticulum0.045

Rank 4 · TkA05G159850 · TK1151

Lysosome / Vacuole0.026

Rank 5 · TkA05G159850 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07732Cu-oxidase_337-150 aa

PF07731Cu-oxidase_260-91 aa

PF00394Cu-oxidase101-119 aa

PF00394Cu-oxidase161-315 aa

PF07731Cu-oxidase_2254-278 aa

PF07732Cu-oxidase_3261-280 aa

PF07731Cu-oxidase_2428-563 aa

PF00394Cu-oxidase453-563 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G159850	`PF07732`	Cu-oxidase_3	37	150	7.3e-45	152.6
TkA05G159850	`PF07731`	Cu-oxidase_2	60	91	8.1e-45	152.7
TkA05G159850	`PF00394`	Cu-oxidase	101	119	4.3e-43	147.8
TkA05G159850	`PF00394`	Cu-oxidase	161	315	4.3e-43	147.8
TkA05G159850	`PF07731`	Cu-oxidase_2	254	278	8.1e-45	152.7
TkA05G159850	`PF07732`	Cu-oxidase_3	261	280	7.3e-45	152.6
TkA05G159850	`PF07731`	Cu-oxidase_2	428	563	8.1e-45	152.7
TkA05G159850	`PF00394`	Cu-oxidase	453	563	4.3e-43	147.8
TkA05G159850	`PF07732`	Cu-oxidase_3	478	487	7.3e-45	152.6
TkA05G159850	`PF07732`	Cu-oxidase_3	530	562	7.3e-45	152.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LMS3`	Arabidopsis thaliana	sp\|Q9LMS3\|LAC1_ARATH Laccase-1	65.000%	Swiss-Prot	High
`Q8VZA1`	Arabidopsis thaliana	sp\|Q8VZA1\|LAC11_ARATH Laccase-11	54.700%	Swiss-Prot	High
`Q5N9X2`	Oryza sativa subsp. japonica	sp\|Q5N9X2\|LAC4_ORYSJ Laccase-4	53.100%	Swiss-Prot	High
`B9FJH4`	Oryza sativa subsp. japonica	sp\|B9FJH4\|LAC12_ORYSJ Laccase-12	52.700%	Swiss-Prot	High
`P0DKK6`	Oryza sativa subsp. japonica	sp\|P0DKK6\|LAC13_ORYSJ Laccase-13	52.700%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card