TkA05G146690 | RubberDandelionOmics

Gene overview

TkA05G146690

Reference: TK1151 Chr: Chr05 Coordinates: 38066817-38072752 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA No cDNA sequence available

cDNA

No cDNA sequence is available for this reference.

CDS

Download CDS FASTA

1536 bp · TkA05G146690|TK1151|CDS

ATGAGGTCATCTTCCGGAGCAATCAATGTAGCCGCCAGCGCACAGAAGATAAACGTCGATAATCGAATTTCTCTCCGTTTCTACTACCGGATCGCGGAAAACATCCTCCGCCAGGCTGCCATCTTCCGACAAGAGAAGAATATTATCGATCTATATATTATGCTCCTAAGGTTTTTAAGTTTGGCTACAGAAACAATACCATTTCATCGAGAGTATAGAGCATCTCTTCAAGGAGACAAGCTTTTACTTAAGAAGAGATC...

Protein

Download Protein FASTA

511 aa · TkA05G146690|TK1151|PROTEIN

MRSSSGAINVAASAQKINVDNRISLRFYYRIAENILRQAAIFRQEKNIIDLYIMLLRFLSLATETIPFHREYRASLQGDKLLLKKRSSSALTELEGLKPAVKQKIEELSRKHTYQSNGWSNLPQTKLLESSKSLPSVSLQNSVNSYDAINKYQAPQFNGYGYQDTRIQMYSPTNTLEEQTRQLSLNIPRAREETLSRHSILGPNGLRGQWQPPTFNVAVRYPSNIDLSPVEIPRENKLHMLENGSSVEKFTSNLQHEKPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G146690`
TK1151 ID	TkA05G146690
OH-1004 ID	LXL04_020203
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	94.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G146690

Location Chr05:38066817-38072752 (-)

Description Similar to AMSH1: AMSH-like ubiquitin thioesterase 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g48790`	Zinc metalloprotease that cleaves 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains.	No verified direct reference in this release
`At4g16144`	Zinc metalloprotease that cleaves 'Lys-48'- and 'Lys-63'- linked polyubiquitin chains, but is not implicated in protein degradation by the 26S proteasome, deneddylation, or desumoylation.	The deubiquitinating enzyme AMSH3 is required for intracellular trafficking and vacuole biogenesis in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.075952
`At1g10600`	Zinc metalloprotease that cleaves 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020203 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0006897 endocytosis Biological Process

GO:0007033 vacuole organization Biological Process

GO:0015031 protein transport Biological Process

GO:0032511 late endosome to vacuole transport via multivesicular body sorting pathway Biological Process

GO:0043328 protein transport to vacuole involved in ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway Biological Process

GO:0044090 positive regulation of vacuole organization Biological Process

GO:0045324 late endosome to vacuole transport Biological Process

GO:0070536 protein K63-linked deubiquitination Biological Process

GO:0071108 protein K48-linked deubiquitination Biological Process

GO:0090316 positive regulation of intracellular protein transport Biological Process

GO:0120113 cytoplasm to vacuole targeting by the NVT pathway Biological Process

KEGG gene cross-reference

ath:AT1G10600

ath:AT1G48790

ddi:DDB_G0284037

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.603

Rank 1 · TkA05G146690 · TK1151

Golgi apparatus0.201

Rank 2 · TkA05G146690 · TK1151

Cell membrane0.188

Rank 3 · TkA05G146690 · TK1151

Nucleus0.163

Rank 4 · TkA05G146690 · TK1151

Endoplasmic reticulum0.083

Rank 5 · TkA05G146690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06282DUF10364-39 aa

PF08969USP8_dimer12-104 aa

PF06282DUF1036110-123 aa

PF01398JAB334-441 aa

PF17833pre-PUA_NIP7345-376 aa

PF14464Prok-JAB350-434 aa

PF06282DUF1036360-406 aa

PF06282DUF1036403-436 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G146690	`PF06282`	DUF1036	4	39	0.036	15.4
TkA05G146690	`PF08969`	USP8_dimer	12	104	6.1e-12	46.4
TkA05G146690	`PF06282`	DUF1036	110	123	0.036	15.4
TkA05G146690	`PF01398`	JAB	334	441	3.6e-19	69.4
TkA05G146690	`PF17833`	pre-PUA_NIP7	345	376	0.24	12.4
TkA05G146690	`PF14464`	Prok-JAB	350	434	1.9e-08	34.9
TkA05G146690	`PF06282`	DUF1036	360	406	0.036	15.4
TkA05G146690	`PF06282`	DUF1036	403	436	0.036	15.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYB5`	Arabidopsis thaliana	sp\|Q8VYB5\|AMSH1_ARATH AMSH-like ubiquitin thioesterase 1	60.500%	Swiss-Prot	High
`Q5PNU3`	Arabidopsis thaliana	sp\|Q5PNU3\|AMSH3_ARATH AMSH-like ubiquitin thioesterase 3	45.900%	Swiss-Prot	Medium
`Q6NKP9`	Arabidopsis thaliana	sp\|Q6NKP9\|AMSH2_ARATH AMSH-like ubiquitin thioesterase 2	57.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card