RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA05G141800
Reference: TK1151 Chr: Chr05 Coordinates: 36860754-36864511 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2511 bp · TkA05G141800|TK1151|cDNA

AAAAAAGAGAAATGATATTTAAACATCGATATAAGAACACGTATATCATTCCAAACCACATCCATTCTCTCTTATAGTCTTATACCACTCGATCCACTCCCATCTCTTTAGCAAATCACCCCCACCTTCCTCCCCAATAAGGTACTACTCTCTCTGGTTCACTATTAATATGTGTTCATGTTGAGTTTTTAGTTAATTTCCTCCGGATTTGGGGCATCGGTTCGTTTTTATCACTACTAATTCCAGACCTTTCTACAATG...

CDS

Download CDS FASTA

2079 bp · TkA05G141800|TK1151|CDS

ATGGCGGCATCTTCTGCATGTATTGTAGGAAACGGTTTATCCACTCGCAAGCATTTCCACATCTCTCCTACCCTCCCATCTCTCGATAAATCCCCAAAAGTAAGAATCATAACCGCCTCTCTAGACAAAAAGCCACACGACCGAAGAGGCTTCCTCAAATTACTCCTCGGAAACGCCGGAATCGCAACTCCGGCCTTACTCACCACCGGAATCGCCAACGCCGCCGACGACCAAGGCGTTTCCAACTCCAGAATGTCGTA...

Protein

Download Protein FASTA

692 aa · TkA05G141800|TK1151|PROTEIN

MAASSACIVGNGLSTRKHFHISPTLPSLDKSPKVRIITASLDKKPHDRRGFLKLLLGNAGIATPALLTTGIANAADDQGVSNSRMSYSRFLEYLDKDRVNKVDLFENGTIAIVEAVSPELGNRVQRVRVQLPGLSQELLQKFREKNIDFAAHNAQEDSGSLIFNLIGNLAFPLILIGGLFLLSRRSPGGMGGPGGPGNPLAFGQSKAKFQMEPNTGVTFDDVAGVDEAKQDFQEVVEFLKKPERFTAVGARIPKGVLLVG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA05G141800
TK1151 IDTkA05G141800
OH-1004 IDLXL04_020131
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.300
Protein coverage (%)TK1151 98.410 / OH-1004 94.061
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA05G141800
LocationChr05:36860754-36864511 (+)
DescriptionSimilar to FTSH2: ATP-dependent zinc metalloprotease FTSH 2, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g30950 Part of a complex that function as an ATP-dependent zinc metallopeptidase.
Mutations in the Arabidopsis VAR2 locus cause leaf variegation due to the loss of a chloroplast FtsH protease.2000 · DOI: 10.1046/j.1365-313x.2000.00738.x
A critical role for the Var2 FtsH homologue of Arabidopsis thaliana in the photosystem II repair cycle in vivo.2002 · DOI: 10.1074/jbc.m105878200
Coordinated regulation and complex formation of yellow variegated1 and yellow variegated2, chloroplastic FtsH metalloproteases involved in the repair cycle of photosystem II in Arabidopsis thylakoid membranes.2003 · DOI: 10.1105/tpc.017319
At1g06430 Part of a complex that function as an ATP-dependent zinc metallopeptidase. No verified direct reference in this release
At5g15250 Probable ATP-dependent zinc metallopeptidase.
AtFtsH6 is involved in the degradation of the light-harvesting complex II during high-light acclimation and senescence.2005 · DOI: 10.1073/pnas.0503472102

Rice

Reference gene IDPossible functionPapers / DOI
Os06g0669400 Probable ATP-dependent zinc metallopeptidase. No verified direct reference in this release
Os06g0229066 Probable ATP-dependent zinc metallopeptidase. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_020131 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006508 proteolysis Biological Process
GO:0009658 chloroplast organization Biological Process
GO:0010027 thylakoid membrane organization Biological Process
GO:0010205 photoinhibition Biological Process
GO:0010206 photosystem II repair Biological Process
GO:0010304 PSII associated light-harvesting complex II catabolic process Biological Process
GO:0030163 protein catabolic process Biological Process
GO:0048564 photosystem I assembly Biological Process
GO:0072593 reactive oxygen species metabolic process Biological Process
GO:0005576 extracellular region Cellular Component
GO:0005777 peroxisome Cellular Component
GO:0009507 chloroplast Cellular Component
KEGG gene cross-reference
ath:AT1G06430
ath:AT2G30950
ath:AT5G15250
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.958
Rank 1 · TkA05G141800 · TK1151
Mitochondrion0.058
Rank 2 · TkA05G141800 · TK1151
Nucleus0.019
Rank 3 · TkA05G141800 · TK1151
Cytoplasm0.017
Rank 4 · TkA05G141800 · TK1151
Cell membrane0.010
Rank 5 · TkA05G141800 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06480FtsH_ext76-151 aa
PF13191AAA_1683-145 aa
PF13401AAA_2287-104 aa
PF06745ATPase103-146 aa
PF00004AAA112-163 aa
PF02367TsaE245-279 aa
PF13191AAA_16247-276 aa
PF13245AAA_19253-274 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA05G141800PF06480FtsH_ext761514.4e-0730.8
TkA05G141800PF13191AAA_16831450.0002122.5
TkA05G141800PF13401AAA_22871040.00120.1
TkA05G141800PF06745ATPase1031460.08313.0
TkA05G141800PF00004AAA1121635.8e-47160.1
TkA05G141800PF02367TsaE2452790.212.3
TkA05G141800PF13191AAA_162472760.0002122.5
TkA05G141800PF13245AAA_192532740.2912.0
TkA05G141800PF06068TIP492542901.1e-0525.5
TkA05G141800PF01078Mg_chelatase2542740.008616.2
TkA05G141800PF12775AAA_72542740.07713.3
TkA05G141800PF06745ATPase2542710.08313.0
TkA05G141800PF07728AAA_52553276.8e-0523.6
TkA05G141800PF05496RuvB_N2552890.0001422.4
TkA05G141800PF01695IstB_IS212552770.01116.0
TkA05G141800PF00004AAA2563885.8e-47160.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O80860Arabidopsis thalianasp|O80860|FTSH2_ARATH ATP-dependent zinc metalloprotease FTSH 2, chloroplastic87.000%Swiss-ProtHigh
Q8W585Arabidopsis thalianasp|Q8W585|FTSH8_ARATH ATP-dependent zinc metalloprotease FTSH 8, chloroplastic86.500%Swiss-ProtHigh
Q1PDW5Arabidopsis thalianasp|Q1PDW5|FTSH6_ARATH ATP-dependent zinc metalloprotease FTSH 6, chloroplastic67.000%Swiss-ProtHigh
Q655S1Oryza sativa subsp. japonicasp|Q655S1|FTSH2_ORYSJ ATP-dependent zinc metalloprotease FTSH 2, chloroplastic88.400%Swiss-ProtHigh
Q67WJ2Oryza sativa subsp. japonicasp|Q67WJ2|FTSH6_ORYSJ ATP-dependent zinc metalloprotease FTSH 6, chloroplastic67.700%Swiss-ProtHigh

JBrowse

View in Genome Browser