TkA05G133470 | RubberDandelionOmics

Gene overview

TkA05G133470

Reference: TK1151 Chr: Chr05 Coordinates: 34928844-34942930 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1293 bp · TkA05G133470|TK1151|cDNA

CATTCTACTACCAGGATTGATTTAGTCGATACCCGAGCCAGATCGACGGACGTGGAAAGAGGGATAGCAGGTCTGCCAGGTCAGACTGATGCTACCAACACCTTGGCTCTTCTCGCTGAAGGCCGTTCCAATCACGCTATGCCCCCGAGACGTCGCGGCCGTCCAACCGGAACTGGCGGTGCCCCACCAGTCTTTGACCCAGCGGCCATGGAGGCCATTATAGATCAAAGGGTAACAGAAGCCCTGGTAGCTTACGAACT...

CDS

Download CDS FASTA

1293 bp · TkA05G133470|TK1151|CDS

CATTCTACTACCAGGATTGATTTAGTCGATACCCGAGCCAGATCGACGGACGTGGAAAGAGGGATAGCAGGTCTGCCAGGTCAGACTGATGCTACCAACACCTTGGCTCTTCTCGCTGAAGGCCGTTCCAATCACGCTATGCCCCCGAGACGTCGCGGCCGTCCAACCGGAACTGGCGGTGCCCCACCAGTCTTTGACCCAGCGGCCATGGAGGCCATTATAGATCAAAGGGTAACAGAAGCCCTGGTAGCTTACGAACT...

Protein

Download Protein FASTA

430 aa · TkA05G133470|TK1151|PROTEIN

HSTTRIDLVDTRARSTDVERGIAGLPGQTDATNTLALLAEGRSNHAMPPRRRGRPTGTGGAPPVFDPAAMEAIIDQRVTEALVAYELAHPGNGNDGGGGAGNPGGNGGNPKPCSYKDFMNCKPRDFAGTGGVIELTRWFEETESVFQICDCPASCQVKFAACTFMRAALSWWNTHVQTMGIVQANALTWGELKAMMIEEYCPRSELQKLEQELWNLTMKGSDITGYTNRFNDLSVLCPMMVTPLAKKIERYIWGLSAQIQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G133470`
TK1151 ID	TkA05G133470
OH-1004 ID	LXL04_004623
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	80.700
Protein coverage (%)	TK1151 99.767 / OH-1004 18.430 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G133470`
Location	Chr05:34928844-34942930 (-)
Description	Similar to TY3B-G: Transposon Ty3-G Gag-Pol polyprotein (Saccharomyces cerevisiae (strain ATCC 204508 / S288c)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_004623` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006310 DNA recombination Biological Process GO:0006508 proteolysis Biological Process GO:0015074 DNA integration Biological Process GO:0075523 viral translational frameshifting Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0003677 DNA binding Molecular Function GO:0003723 RNA binding Molecular Function GO:0003887 DNA-directed DNA polymerase activity Molecular Function GO:0003964 RNA-directed DNA polymerase activity Molecular Function GO:0004190 aspartic-type endopeptidase activity Molecular Function GO:0004523 RNA-DNA hybrid ribonuclease activity Molecular Function
KEGG gene cross-reference	sce:YGR109W-B These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.567

Rank 1 · TkA05G133470 · TK1151

Nucleus0.522

Rank 2 · TkA05G133470 · TK1151

Cell membrane0.064

Rank 3 · TkA05G133470 · TK1151

Endoplasmic reticulum0.057

Rank 4 · TkA05G133470 · TK1151

Mitochondrion0.048

Rank 5 · TkA05G133470 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF19259Ty3_capsid117-281 aa

PF03732PEG10_N-capsid123-200 aa

PF08704GCD14258-341 aa

PF29676Saf6_C271-368 aa

PF05053Menin284-343 aa

PF22575Vir1p305-333 aa

PF29740DDB_G0287209_N307-332 aa

PF00098zf-CCHC360-371 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G133470	`PF19259`	Ty3_capsid	117	281	8.2e-09	35.9
TkA05G133470	`PF03732`	PEG10_N-capsid	123	200	2.4e-07	31.7
TkA05G133470	`PF08704`	GCD14	258	341	0.041	14.2
TkA05G133470	`PF29676`	Saf6_C	271	368	0.39	10.6
TkA05G133470	`PF05053`	Menin	284	343	0.82	8.6
TkA05G133470	`PF22575`	Vir1p	305	333	1.6	7.0
TkA05G133470	`PF29740`	DDB_G0287209_N	307	332	0.72	8.3
TkA05G133470	`PF00098`	zf-CCHC	360	371	3.4e-06	27.6
TkA05G133470	`PF27939`	DUF8363	360	410	0.11	13.1
TkA05G133470	`PF00098`	zf-CCHC	388	405	3.4e-06	27.6
TkA05G133470	`PF30379`	SLU7_N	388	403	0.12	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card